Transcript: Human XM_024453274.1

PREDICTED: Homo sapiens IQ motif containing GTPase activating protein 3 (IQGAP3), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
IQGAP3 (128239)
Length:
6061
CDS:
52..4980

Additional Resources:

NCBI RefSeq record:
XM_024453274.1
NBCI Gene record:
IQGAP3 (128239)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_024453274.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000417961 GCGTCCGAACTGGCCAAATAT pLKO_005 592 CDS 100% 15.000 21.000 N IQGAP3 n/a
2 TRCN0000419456 ATTCCGTATGGGATGCGATAT pLKO_005 3502 CDS 100% 10.800 15.120 N IQGAP3 n/a
3 TRCN0000047508 CCTCGCCATGACTGATAAGTT pLKO.1 3450 CDS 100% 5.625 7.875 N IQGAP3 n/a
4 TRCN0000047512 GCCGATATCATACAGTTCCAT pLKO.1 4204 CDS 100% 3.000 4.200 N IQGAP3 n/a
5 TRCN0000413820 CTCAGTGTGGTACGCAGATTT pLKO_005 2635 CDS 100% 13.200 9.240 N IQGAP3 n/a
6 TRCN0000425897 GCTGAAATCCAGGGCAATATC pLKO_005 910 CDS 100% 13.200 9.240 N IQGAP3 n/a
7 TRCN0000047511 GCCCAAGATGACTACAGGATA pLKO.1 2590 CDS 100% 4.950 3.465 N IQGAP3 n/a
8 TRCN0000047509 GCCAAAGTCAATGTCAACCTT pLKO.1 4921 CDS 100% 3.000 2.100 N IQGAP3 n/a
9 TRCN0000047510 GCAGCTGTTCTTGCCATCAAT pLKO.1 691 CDS 100% 5.625 3.375 N IQGAP3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_024453274.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09511 pDONR223 100% 99% 98.9% None (many diffs) n/a
2 ccsbBroad304_09511 pLX_304 0% 99% 98.9% V5 (many diffs) n/a
3 TRCN0000471612 TCTGGAAACGCGAGTCAAAATAGG pLX_317 5.6% 99% 98.9% V5 (many diffs) n/a
Download CSV