Transcript: Human XM_024453413.1

PREDICTED: Homo sapiens nucleoporin 210 (NUP210), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
NUP210 (23225)
Length:
5084
CDS:
550..3741

Additional Resources:

NCBI RefSeq record:
XM_024453413.1
NBCI Gene record:
NUP210 (23225)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_024453413.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000153724 CCCACAACAGATTGAAGTCTT pLKO.1 1113 CDS 100% 4.950 6.930 N NUP210 n/a
2 TRCN0000157497 GTCGTTTACGTGTCGGACATT pLKO.1 814 CDS 100% 4.950 6.930 N NUP210 n/a
3 TRCN0000153158 GAGCAGTTAGAAGTGCTCTTT pLKO.1 3982 3UTR 100% 0.495 0.396 N NUP210 n/a
4 TRCN0000156619 GCTCTGCCCATTAGCTCATTT pLKO.1 3799 3UTR 100% 13.200 9.240 N NUP210 n/a
5 TRCN0000157612 GCCGTCTTTGATTTCCCATCT pLKO.1 2752 CDS 100% 4.050 2.835 N NUP210 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_024453413.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10330 pDONR223 100% 8.1% 7.2% None (many diffs) n/a
2 ccsbBroad304_10330 pLX_304 0% 8.1% 7.2% V5 (many diffs) n/a
3 TRCN0000465268 CTATTTCCCGGATACTTTTTCGAA pLX_317 73.3% 8.1% 7.2% V5 (many diffs) n/a
Download CSV