Transcript: Human XM_024453499.1

PREDICTED: Homo sapiens acylaminoacyl-peptide hydrolase (APEH), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
APEH (327)
Length:
2593
CDS:
13..2427

Additional Resources:

NCBI RefSeq record:
XM_024453499.1
NBCI Gene record:
APEH (327)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_024453499.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000046692 GAACACTTTGATGCAAGCCAT pLKO.1 1948 CDS 100% 2.640 3.696 N APEH n/a
2 TRCN0000291381 GAACACTTTGATGCAAGCCAT pLKO_005 1948 CDS 100% 2.640 3.696 N APEH n/a
3 TRCN0000046688 CCTGTATTATGTGGACCTCAT pLKO.1 990 CDS 100% 4.050 2.835 N APEH n/a
4 TRCN0000291378 CCTGTATTATGTGGACCTCAT pLKO_005 990 CDS 100% 4.050 2.835 N APEH n/a
5 TRCN0000046690 CGAGTCCTTCTTTCAGACCAA pLKO.1 666 CDS 100% 2.640 1.848 N APEH n/a
6 TRCN0000291379 CGAGTCCTTCTTTCAGACCAA pLKO_005 666 CDS 100% 2.640 1.848 N APEH n/a
7 TRCN0000046689 GCGGTACTACTAGTGAACTAT pLKO.1 1819 CDS 100% 0.000 0.000 N APEH n/a
8 TRCN0000291380 GCGGTACTACTAGTGAACTAT pLKO_005 1819 CDS 100% 0.000 0.000 N APEH n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_024453499.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05833 pDONR223 100% 84.2% 78% None (many diffs) n/a
2 ccsbBroad304_05833 pLX_304 0% 84.2% 78% V5 (many diffs) n/a
3 TRCN0000471424 ATGGGTTCAGTGATTCTGTGGCCA pLX_317 19.3% 84.2% 78% V5 (many diffs) n/a
Download CSV