Transcript: Human XM_024453708.1

PREDICTED: Homo sapiens helicase for meiosis 1 (HFM1), transcript variant X18, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
HFM1 (164045)
Length:
2543
CDS:
44..2470

Additional Resources:

NCBI RefSeq record:
XM_024453708.1
NBCI Gene record:
HFM1 (164045)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_024453708.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000155884 CTCAGGAGTTAGAGGAAGAAT pLKO.1 186 CDS 100% 5.625 3.938 N HFM1 n/a
2 TRCN0000154493 GCATGTTCAAAGCACCATCTT pLKO.1 744 CDS 100% 4.950 3.465 N HFM1 n/a
3 TRCN0000154492 GATACTCAGGAGTTAGAGGAA pLKO.1 182 CDS 100% 2.640 1.848 N HFM1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_024453708.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13338 pDONR223 100% 57.7% 57.4% None (many diffs) n/a
2 ccsbBroad304_13338 pLX_304 0% 57.7% 57.4% V5 (many diffs) n/a
3 TRCN0000478713 TTGATCCCTTTGCTCACACAGTTT pLX_317 22.9% 57.7% 57.4% V5 (many diffs) n/a
4 ccsbBroadEn_15274 pDONR223 91.1% 47.8% 7.1% None (many diffs) n/a
5 ccsbBroad304_15274 pLX_304 0% 47.8% 7.1% V5 (not translated due to prior stop codon) (many diffs) n/a
6 TRCN0000475533 GGCCTGTGTCTGACCATTGCGCAA pLX_317 1.5% 47.8% 7.1% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV