Transcript: Human XM_024453789.1

PREDICTED: Homo sapiens beaded filament structural protein 2 (BFSP2), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
BFSP2 (8419)
Length:
1110
CDS:
404..874

Additional Resources:

NCBI RefSeq record:
XM_024453789.1
NBCI Gene record:
BFSP2 (8419)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_024453789.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000116362 CCTGCTGGATTCCCTGGTTAA pLKO.1 967 3UTR 100% 10.800 7.560 N BFSP2 n/a
2 TRCN0000429615 AGTTGCTTGAGGAGCTTTCTC pLKO_005 933 3UTR 100% 4.950 3.465 N BFSP2 n/a
3 TRCN0000116366 CAGTGGGAGAGAGATGTTGAA pLKO.1 458 CDS 100% 4.950 3.465 N BFSP2 n/a
4 TRCN0000116364 CATCCTTGAGACGATCAGAAT pLKO.1 436 CDS 100% 4.950 3.465 N BFSP2 n/a
5 TRCN0000428536 TCAGGGTGGAGTTACACAACA pLKO_005 576 CDS 100% 4.950 3.465 N BFSP2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_024453789.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01926 pDONR223 100% 37.5% 37.5% None 0_1ins777 n/a
2 ccsbBroad304_01926 pLX_304 0% 37.5% 37.5% V5 0_1ins777 n/a
3 TRCN0000479251 GAGCCATAGAGTGGACTCTTCCGC pLX_317 44.7% 37.5% 37.5% V5 0_1ins777 n/a
Download CSV