Transcript: Human XM_024453882.1

PREDICTED: Homo sapiens stimulator of chondrogenesis 1 (SCRG1), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
SCRG1 (11341)
Length:
755
CDS:
280..576

Additional Resources:

NCBI RefSeq record:
XM_024453882.1
NBCI Gene record:
SCRG1 (11341)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_024453882.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000378984 GGAGAACACCATTCCTGATTT pLKO_005 594 3UTR 100% 13.200 18.480 N SCRG1 n/a
2 TRCN0000063830 GATGATCTGTTACTGCAACTT pLKO.1 477 CDS 100% 4.950 3.960 N SCRG1 n/a
3 TRCN0000373409 CAATGAGAATCTTCATGTATT pLKO_005 571 CDS 100% 13.200 9.240 N SCRG1 n/a
4 TRCN0000063828 CCTCTCTTGCTACAGAAAGAT pLKO.1 354 CDS 100% 5.625 3.938 N SCRG1 n/a
5 TRCN0000063829 GCTGACCTGACACAGATTGAT pLKO.1 415 CDS 100% 5.625 3.938 N SCRG1 n/a
6 TRCN0000373481 TCAATGTCCAGGATCATTTCT pLKO_005 437 CDS 100% 5.625 3.938 N SCRG1 n/a
7 TRCN0000063832 CTTTGGACCAAAGATCTCTTT pLKO.1 531 CDS 100% 4.950 3.465 N SCRG1 n/a
8 TRCN0000063831 CTAACTTTGCTGCTAGGAGTT pLKO.1 313 CDS 100% 4.050 2.835 N SCRG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_024453882.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11624 pDONR223 100% 60.2% 60.2% None 178_294del n/a
2 ccsbBroad304_11624 pLX_304 0% 60.2% 60.2% V5 178_294del n/a
3 TRCN0000469644 TCGAAATAAGCCCCTAAACTCACG pLX_317 100% 60.2% 60.2% V5 178_294del n/a
Download CSV