Transcript: Human XM_024453966.1

PREDICTED: Homo sapiens gamma-aminobutyric acid type A receptor alpha2 subunit (GABRA2), transcript variant X5, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
GABRA2 (2555)
Length:
8664
CDS:
369..1904

Additional Resources:

NCBI RefSeq record:
XM_024453966.1
NBCI Gene record:
GABRA2 (2555)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_024453966.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000230935 TATGAATATCCTTCGACTAAA pLKO_005 689 CDS 100% 13.200 18.480 N GABRA2 n/a
2 TRCN0000061180 CCCAAGTTTCATTCTGGCTTA pLKO.1 1171 CDS 100% 4.050 3.240 N GABRA2 n/a
3 TRCN0000230934 ATGGAAAGATGAACGTTTAAA pLKO_005 656 CDS 100% 15.000 10.500 N GABRA2 n/a
4 TRCN0000230936 CCTGATGGCTCTAGGTTAAAT pLKO_005 996 CDS 100% 15.000 10.500 N GABRA2 n/a
5 TRCN0000230937 TATGTACAGTCTGACTAATAA pLKO_005 1962 3UTR 100% 15.000 10.500 N GABRA2 n/a
6 TRCN0000218632 ATGATACAGAACAACGCTTAT pLKO_005 1629 CDS 100% 10.800 7.560 N GABRA2 n/a
7 TRCN0000061178 CCATGTTATCTTTGGGATGTA pLKO.1 1913 3UTR 100% 4.950 3.465 N GABRA2 n/a
8 TRCN0000061182 GCCAAATAAGTTGCTTCGAAT pLKO.1 791 CDS 100% 4.950 3.465 N GABRA2 n/a
9 TRCN0000061179 CCTATGAATATCCTTCGACTA pLKO.1 687 CDS 100% 4.050 2.835 N GABRA2 n/a
10 TRCN0000061181 GCCCTGTCTCAGATACAGATA pLKO.1 601 CDS 100% 4.950 2.970 N GABRA2 n/a
11 TRCN0000423829 CTGAAGTCTTCACTAACATTT pLKO_005 565 CDS 100% 13.200 18.480 N Gabra2 n/a
12 TRCN0000166364 CACACACACACACACACACAA pLKO.1 3152 3UTR 100% 4.950 2.475 Y KAAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_024453966.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10832 pDONR223 100% 71.2% 69.4% None (many diffs) n/a
2 ccsbBroad304_10832 pLX_304 0% 71.2% 69.4% V5 (many diffs) n/a
Download CSV