Transcript: Human XM_024453972.1

PREDICTED: Homo sapiens gamma-aminobutyric acid type A receptor alpha2 subunit (GABRA2), transcript variant X13, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
GABRA2 (2555)
Length:
6647
CDS:
324..1514

Additional Resources:

NCBI RefSeq record:
XM_024453972.1
NBCI Gene record:
GABRA2 (2555)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_024453972.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000230935 TATGAATATCCTTCGACTAAA pLKO_005 479 CDS 100% 13.200 18.480 N GABRA2 n/a
2 TRCN0000061180 CCCAAGTTTCATTCTGGCTTA pLKO.1 961 CDS 100% 4.050 3.240 N GABRA2 n/a
3 TRCN0000230934 ATGGAAAGATGAACGTTTAAA pLKO_005 446 CDS 100% 15.000 10.500 N GABRA2 n/a
4 TRCN0000230936 CCTGATGGCTCTAGGTTAAAT pLKO_005 786 CDS 100% 15.000 10.500 N GABRA2 n/a
5 TRCN0000230937 TATGTACAGTCTGACTAATAA pLKO_005 1572 3UTR 100% 15.000 10.500 N GABRA2 n/a
6 TRCN0000218632 ATGATACAGAACAACGCTTAT pLKO_005 1239 CDS 100% 10.800 7.560 N GABRA2 n/a
7 TRCN0000061178 CCATGTTATCTTTGGGATGTA pLKO.1 1523 3UTR 100% 4.950 3.465 N GABRA2 n/a
8 TRCN0000061182 GCCAAATAAGTTGCTTCGAAT pLKO.1 581 CDS 100% 4.950 3.465 N GABRA2 n/a
9 TRCN0000061179 CCTATGAATATCCTTCGACTA pLKO.1 477 CDS 100% 4.050 2.835 N GABRA2 n/a
10 TRCN0000166364 CACACACACACACACACACAA pLKO.1 2762 3UTR 100% 4.950 2.475 Y KAAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_024453972.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10832 pDONR223 100% 67.6% 61.8% None (many diffs) n/a
2 ccsbBroad304_10832 pLX_304 0% 67.6% 61.8% V5 (many diffs) n/a
Download CSV