Transcript: Human XM_024453989.1

PREDICTED: Homo sapiens FRY like transcription coactivator (FRYL), transcript variant X4, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
FRYL (285527)
Length:
11767
CDS:
597..9914

Additional Resources:

NCBI RefSeq record:
XM_024453989.1
NBCI Gene record:
FRYL (285527)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_024453989.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000263080 AGTACAACTGGTACGAATATT pLKO_005 3812 CDS 100% 15.000 21.000 N FRYL n/a
2 TRCN0000282485 AGTGCCTTAGTGGCGAATATT pLKO_005 4005 CDS 100% 15.000 21.000 N FRYL n/a
3 TRCN0000263077 AGTTGCACACTTAGATTATAA pLKO_005 5918 CDS 100% 15.000 10.500 N FRYL n/a
4 TRCN0000263078 CGCATCACTTCCAGCTATAAA pLKO_005 5268 CDS 100% 15.000 10.500 N FRYL n/a
5 TRCN0000263079 TGTCTAAGTCTGTAGTATAAC pLKO_005 11176 3UTR 100% 13.200 9.240 N FRYL n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_024453989.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13553 pDONR223 100% 12.9% 12.9% None 1_8088del;8739_8756del n/a
2 ccsbBroad304_13553 pLX_304 0% 12.9% 12.9% V5 1_8088del;8739_8756del n/a
3 TRCN0000469567 TTGGATCTCAGGTTGACTCAGATT pLX_317 41.1% 12.9% 12.9% V5 1_8088del;8739_8756del n/a
Download CSV