Transcript: Human XM_024453992.1

PREDICTED: Homo sapiens FRY like transcription coactivator (FRYL), transcript variant X10, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
FRYL (285527)
Length:
11397
CDS:
458..9544

Additional Resources:

NCBI RefSeq record:
XM_024453992.1
NBCI Gene record:
FRYL (285527)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_024453992.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000263080 AGTACAACTGGTACGAATATT pLKO_005 3442 CDS 100% 15.000 21.000 N FRYL n/a
2 TRCN0000282485 AGTGCCTTAGTGGCGAATATT pLKO_005 3635 CDS 100% 15.000 21.000 N FRYL n/a
3 TRCN0000263077 AGTTGCACACTTAGATTATAA pLKO_005 5548 CDS 100% 15.000 10.500 N FRYL n/a
4 TRCN0000263078 CGCATCACTTCCAGCTATAAA pLKO_005 4898 CDS 100% 15.000 10.500 N FRYL n/a
5 TRCN0000263079 TGTCTAAGTCTGTAGTATAAC pLKO_005 10806 3UTR 100% 13.200 9.240 N FRYL n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_024453992.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13553 pDONR223 100% 13.3% 13.3% None 1_7857del;8508_8525del n/a
2 ccsbBroad304_13553 pLX_304 0% 13.3% 13.3% V5 1_7857del;8508_8525del n/a
3 TRCN0000469567 TTGGATCTCAGGTTGACTCAGATT pLX_317 41.1% 13.3% 13.3% V5 1_7857del;8508_8525del n/a
Download CSV