Transcript: Human XM_024454041.1

PREDICTED: Homo sapiens Fc fragment of IgG receptor IIa (FCGR2A), transcript variant X12, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
FCGR2A (2212)
Length:
2488
CDS:
532..1068

Additional Resources:

NCBI RefSeq record:
XM_024454041.1
NBCI Gene record:
FCGR2A (2212)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_024454041.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000436323 ACCTGTGGCTGCTTCAACCAT pLKO_005 45 5UTR 100% 3.000 2.100 N FCGR2A n/a
2 TRCN0000414699 CATGAATTGCGCCTCAGATTT pLKO_005 1505 3UTR 100% 13.200 6.600 Y FCGR2A n/a
3 TRCN0000029581 CCACAGTCACAGTGGTGATTA pLKO.1 648 CDS 100% 13.200 6.600 Y FCGR2B n/a
4 TRCN0000029575 GCACCTACTGACGATGATAAA pLKO.1 997 CDS 100% 13.200 6.600 Y FCGR2A n/a
5 TRCN0000029577 CCATGTCAACAGTAATAACTA pLKO.1 1047 CDS 100% 5.625 2.813 Y FCGR2A n/a
6 TRCN0000029578 GAAGAAACCAACAATGACTAT pLKO.1 937 CDS 100% 4.950 2.475 Y FCGR2A n/a
7 TRCN0000029574 GCCATCAGAAAGAGACAACTT pLKO.1 916 CDS 100% 4.950 2.475 Y FCGR2A n/a
8 TRCN0000029584 GCCTTGATCTACTGCAGGAAA pLKO.1 823 CDS 100% 4.950 2.475 Y FCGR2C n/a
9 TRCN0000029587 CAGTGGTTCCACAATGGGAAT pLKO.1 218 5UTR 100% 4.050 2.025 Y FCGR2C n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_024454041.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06198 pDONR223 100% 56.2% 56% None 0_1ins414;83A>G n/a
2 ccsbBroad304_06198 pLX_304 0% 56.2% 56% V5 0_1ins414;83A>G n/a
3 TRCN0000472330 ACTGGGGCTCGAGCAGACAGCCGC pLX_317 46.5% 56.2% 56% V5 0_1ins414;83A>G n/a
4 ccsbBroadEn_06199 pDONR223 100% 56.2% 56% None 0_1ins414;235A>G n/a
5 ccsbBroad304_06199 pLX_304 0% 56.2% 56% V5 0_1ins414;235A>G n/a
6 TRCN0000475216 TGCCCATTGCGGCCGTTTAATATC pLX_317 25% 56.2% 56% V5 0_1ins414;235A>G n/a
Download CSV