Construct: ORF TRCN0000475216
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF014812.1_s317c1
- Derived from:
- ccsbBroadEn_06199
- DNA Barcode:
- TGCCCATTGCGGCCGTTTAATATC
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- FCGR2A (2212)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000475216
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
---|---|---|---|---|---|---|---|---|
1 | human | 2212 | FCGR2A | Fc fragment of IgG receptor... | NM_021642.4 | 99.8% | 99.6% | 649A>G |
2 | human | 2212 | FCGR2A | Fc fragment of IgG receptor... | NM_001136219.2 | 99.5% | 99.3% | 106_108delGCA;652A>G |
3 | human | 2212 | FCGR2A | Fc fragment of IgG receptor... | XM_011509290.2 | 98.6% | 98.4% | (many diffs) |
4 | human | 2212 | FCGR2A | Fc fragment of IgG receptor... | XM_017000664.1 | 89.3% | 88.3% | (many diffs) |
5 | human | 2212 | FCGR2A | Fc fragment of IgG receptor... | XM_017000665.1 | 89.3% | 88.3% | (many diffs) |
6 | human | 9103 | FCGR2C | Fc fragment of IgG receptor... | NM_201563.5 | 88.1% | 81.8% | (many diffs) |
7 | human | 2212 | FCGR2A | Fc fragment of IgG receptor... | XM_017000668.2 | 87% | 87% | 614_615ins123 |
8 | human | 2212 | FCGR2A | Fc fragment of IgG receptor... | XM_017000667.1 | 86.7% | 86.7% | 106_108delGCA;617_618ins123 |
9 | human | 2212 | FCGR2A | Fc fragment of IgG receptor... | XM_017000663.2 | 85.5% | 85% | 649A>G;941_942delCAinsGT;948_1104delinsC |
10 | human | 2212 | FCGR2A | Fc fragment of IgG receptor... | XM_011509287.2 | 85.2% | 84.8% | (many diffs) |
11 | human | 2212 | FCGR2A | Fc fragment of IgG receptor... | XM_011509291.1 | 81.9% | 78.5% | (many diffs) |
12 | human | 2213 | FCGR2B | Fc fragment of IgG receptor... | NM_004001.4 | 76.9% | 60.7% | (many diffs) |
13 | human | 2213 | FCGR2B | Fc fragment of IgG receptor... | NM_001002275.2 | 76.8% | 60.5% | (many diffs) |
14 | human | 2213 | FCGR2B | Fc fragment of IgG receptor... | XM_024454044.1 | 76.8% | 60.5% | (many diffs) |
15 | human | 2213 | FCGR2B | Fc fragment of IgG receptor... | NM_001190828.1 | 76.6% | 61% | (many diffs) |
16 | human | 2213 | FCGR2B | Fc fragment of IgG receptor... | NM_001002274.2 | 74.9% | 60.6% | (many diffs) |
17 | human | 2213 | FCGR2B | Fc fragment of IgG receptor... | NM_001002273.2 | 74.8% | 60.3% | (many diffs) |
18 | human | 2213 | FCGR2B | Fc fragment of IgG receptor... | XM_024454045.1 | 74.8% | 60.3% | (many diffs) |
19 | human | 2212 | FCGR2A | Fc fragment of IgG receptor... | XM_017000666.1 | 74.2% | 73.9% | (many diffs) |
20 | human | 2213 | FCGR2B | Fc fragment of IgG receptor... | XM_024454043.1 | 71.7% | 58.3% | (many diffs) |
21 | human | 2213 | FCGR2B | Fc fragment of IgG receptor... | XM_017000670.2 | 71.6% | 58% | (many diffs) |
22 | human | 2213 | FCGR2B | Fc fragment of IgG receptor... | XM_024454047.1 | 60.2% | 51.8% | (many diffs) |
23 | human | 2212 | FCGR2A | Fc fragment of IgG receptor... | XR_001737042.1 | 58.4% | (many diffs) | |
24 | human | 2212 | FCGR2A | Fc fragment of IgG receptor... | XM_024454041.1 | 56.2% | 56% | 0_1ins414;235A>G |
25 | human | 2212 | FCGR2A | Fc fragment of IgG receptor... | XM_024454040.1 | 48% | 47.5% | (many diffs) |
26 | human | 9103 | FCGR2C | Fc fragment of IgG receptor... | NR_047648.1 | 34.7% | (many diffs) | |
27 | human | 2213 | FCGR2B | Fc fragment of IgG receptor... | XR_002959731.1 | 32.5% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1014
- ORF length:
- 948
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgac tatggagacc caaatgtctc agaatgtatg tcccagaaac ctgtggctgc 121 ttcaaccatt gacagttttg ctgctgctgg cttctgcaga cagtcaagct gctcccccaa 181 aggctgtgct gaaacttgag cccccgtgga tcaacgtgct ccaggaggac tctgtgactc 241 tgacatgcca gggggctcgc agccctgaga gcgactccat tcagtggttc cacaatggga 301 atctcattcc cacccacacg cagcccagct acaggttcaa ggccaacaac aatgacagcg 361 gggagtacac gtgccagact ggccagacca gcctcagcga ccctgtgcat ctgactgtgc 421 tttccgaatg gctggtgctc cagacccctc acctggagtt ccaggaggga gaaaccatca 481 tgctgaggtg ccacagctgg aaggacaagc ctctggtcaa ggtcacattc ttccagaatg 541 gaaaatccca gaaattctcc catttggatc ccaccttctc catcccacaa gcaaaccaca 601 gtcacagtgg tgattaccac tgcacaggaa acataggcta cacgctgttc tcatccaagc 661 ctgtgaccat cactgtccaa gtgcccagca tgggcagctc ttcaccaatg ggggtcattg 721 tggctgtggt cattgcgact gctgtagcag ccattgttgc tgctgtagtg gccttgatct 781 acTGCAGGAA AAAGCGGATT TCAGCCAATT CCACTGATCC TGTGAAGGCT GCCCAATTTG 841 AGCCACCTGG ACGTCAAATG ATTGCCATCA GAAAGAGACA ACTTGAAGAA ACCAACAATG 901 ACTATGAAAC AGCTGACGGC GGCTACATGA CTCTGAACCC CAGGGCACCT ACTGACGATG 961 ATAAAAACAT CTACCTGACT CTTCCTCCCA ACGACCATGT CAACAGTAAT AACTACCCAA 1021 CTTTCTTGTA CAAAGTGGTT GATATCGGTA AGCCTATCCC TAACCCTCTC CTCGGTCTCG 1081 ATTCTACGTA GTAATGAACT AGTCCGTAAC TTGAAAGTAT TTCGATTTCT TGGCTTTATA 1141 TATCTTGTGG AAAGGACGAT GCCCATTGCG GCCGTTTAAT ATCACGCGTT AAGTCgacaa 1201 tcaacctctg gattacaaaa tttgtgaaag att