Transcript: Mouse XM_030244343.1

PREDICTED: Mus musculus acylpeptide hydrolase (Apeh), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-08-08
Taxon:
Mus musculus (mouse)
Gene:
Apeh (235606)
Length:
2268
CDS:
215..2110

Additional Resources:

NCBI RefSeq record:
XM_030244343.1
NBCI Gene record:
Apeh (235606)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_030244343.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000031496 CCTGTATGACTGGTACACCAA pLKO.1 907 CDS 100% 2.640 3.696 N Apeh n/a
2 TRCN0000031495 CCCAAAGCTGAGTCCTTCTTT pLKO.1 422 CDS 100% 5.625 3.938 N Apeh n/a
3 TRCN0000031497 GCAGTACTACTGGTGAACTAT pLKO.1 1502 CDS 100% 5.625 3.938 N Apeh n/a
4 TRCN0000031494 GCTGGATAAATCACCCATCAA pLKO.1 1864 CDS 100% 4.950 3.465 N Apeh n/a
5 TRCN0000031498 CCAGACCAAGAGAATGTACAA pLKO.1 1325 CDS 100% 4.950 2.970 N Apeh n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_030244343.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05833 pDONR223 100% 76.6% 78.1% None (many diffs) n/a
2 ccsbBroad304_05833 pLX_304 0% 76.6% 78.1% V5 (many diffs) n/a
3 TRCN0000471424 ATGGGTTCAGTGATTCTGTGGCCA pLX_317 19.3% 76.6% 78.1% V5 (many diffs) n/a
Download CSV