Transcript: Mouse XM_030244932.1

PREDICTED: Mus musculus transformed mouse 3T3 cell double minute 1 (Mdm1), transcript variant X9, mRNA.

Source:
NCBI, updated 2019-08-08
Taxon:
Mus musculus (mouse)
Gene:
Mdm1 (17245)
Length:
5694
CDS:
3494..4858

Additional Resources:

NCBI RefSeq record:
XM_030244932.1
NBCI Gene record:
Mdm1 (17245)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_030244932.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000338051 GACTGAATACAAGCGAAATTT pLKO_005 3406 5UTR 100% 15.000 21.000 N Mdm1 n/a
2 TRCN0000338054 GCCGTTGTTCCCACGAATAAT pLKO_005 572 5UTR 100% 15.000 21.000 N Mdm1 n/a
3 TRCN0000338052 CAAGAGAACTCGGTCTCATTC pLKO_005 379 5UTR 100% 10.800 15.120 N Mdm1 n/a
4 TRCN0000120592 CCAAGAGAACTCGGTCTCATT pLKO.1 378 5UTR 100% 4.950 6.930 N Mdm1 n/a
5 TRCN0000120595 CCCAAGAGAACTCGGTCTCAT pLKO.1 377 5UTR 100% 4.950 6.930 N Mdm1 n/a
6 TRCN0000338122 GACCATCTGAACCAGATTATG pLKO_005 3806 CDS 100% 13.200 10.560 N Mdm1 n/a
7 TRCN0000338053 TGCACTTGTCTGAGTACAAAG pLKO_005 5041 3UTR 100% 10.800 7.560 N Mdm1 n/a
8 TRCN0000120594 GATAGGCATCTTCGTAAGAAA pLKO.1 542 5UTR 100% 5.625 3.938 N Mdm1 n/a
9 TRCN0000166364 CACACACACACACACACACAA pLKO.1 3195 5UTR 100% 4.950 2.475 Y KAAG1 n/a
10 TRCN0000178741 CACACACATACACACACACAA pLKO.1 3207 5UTR 100% 4.950 2.475 Y Cstad n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_030244932.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.