Transcript: Mouse XM_030245839.1

PREDICTED: Mus musculus family with sequence similarity 222, member B (Fam222b), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-08-08
Taxon:
Mus musculus (mouse)
Gene:
Fam222b (216971)
Length:
3928
CDS:
592..1896

Additional Resources:

NCBI RefSeq record:
XM_030245839.1
NBCI Gene record:
Fam222b (216971)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_030245839.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000246351 TTGATGCAAACGGTGGATTAC pLKO_005 1735 CDS 100% 10.800 15.120 N Fam222b n/a
2 TRCN0000246350 ACCTCCGCTAGCCACTTATTT pLKO_005 3451 3UTR 100% 15.000 12.000 N Fam222b n/a
3 TRCN0000217418 GCAACACGAAGTCCTAATTTA pLKO.1 3328 3UTR 100% 15.000 12.000 N Fam222b n/a
4 TRCN0000138039 GCCAGAACAGCTTGATGCAAA pLKO.1 1724 CDS 100% 4.950 3.960 N FAM222B n/a
5 TRCN0000297453 GCCAGAACAGCTTGATGCAAA pLKO_005 1724 CDS 100% 4.950 3.960 N FAM222B n/a
6 TRCN0000257538 AGATAGTCGAAGTCTTCATAT pLKO_005 1854 CDS 100% 13.200 9.240 N Fam222b n/a
7 TRCN0000246352 ACCGTGTCTACCTCAACTATC pLKO_005 934 CDS 100% 10.800 7.560 N Fam222b n/a
8 TRCN0000193338 CAGATAGTCGAAGTCTTCATA pLKO.1 1853 CDS 100% 5.625 3.938 N Fam222b n/a
9 TRCN0000138920 GTGCACCAGATCAACCAGTTT pLKO.1 1012 CDS 100% 4.950 3.465 N FAM222B n/a
10 TRCN0000297452 GTGCACCAGATCAACCAGTTT pLKO_005 1012 CDS 100% 4.950 3.465 N FAM222B n/a
11 TRCN0000138699 GCAGTCTGCTCATCAATGCAA pLKO.1 1106 CDS 100% 3.000 2.100 N FAM222B n/a
12 TRCN0000246353 GTCGCAGTCTGCTCATCAATG pLKO_005 1103 CDS 100% 10.800 6.480 N Fam222b n/a
13 TRCN0000138047 CATTGTCAAAGTGCCAGCCAA pLKO.1 516 5UTR 100% 2.640 1.584 N FAM222B n/a
14 TRCN0000278429 CATTGTCAAAGTGCCAGCCAA pLKO_005 516 5UTR 100% 2.640 1.584 N FAM222B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_030245839.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03642 pDONR223 100% 73.1% 74.9% None (many diffs) n/a
2 ccsbBroad304_03642 pLX_304 0% 73.1% 74.9% V5 (many diffs) n/a
3 TRCN0000475611 CCGCGTTTTAGGGAGTACTCTCTA pLX_317 17.2% 73.1% 74.9% V5 (many diffs) n/a
Download CSV