Transcript: Mouse XM_030251426.1

PREDICTED: Mus musculus zinc finger, MYM-type 3 (Zmym3), transcript variant X30, mRNA.

Source:
NCBI, updated 2019-08-08
Taxon:
Mus musculus (mouse)
Gene:
Zmym3 (56364)
Length:
1640
CDS:
205..1254

Additional Resources:

NCBI RefSeq record:
XM_030251426.1
NBCI Gene record:
Zmym3 (56364)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_030251426.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

No results found.

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_030251426.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_15662 pDONR223 0% 63.6% 48.1% None (many diffs) n/a
2 ccsbBroad304_15662 pLX_304 0% 63.6% 48.1% V5 (many diffs) n/a
3 TRCN0000467558 GCCCTCCTTGGGACTTACACACTT pLX_317 22.4% 63.6% 48.1% V5 (many diffs) n/a
Download CSV