Construct: ORF TRCN0000467558
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF010410.1_s317c1
- Derived from:
- ccsbBroadEn_15662
- DNA Barcode:
- GCCCTCCTTGGGACTTACACACTT
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- ZMYM3 (9203)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000467558
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
---|---|---|---|---|---|---|---|---|
1 | human | 9203 | ZMYM3 | zinc finger MYM-type contai... | NM_001171163.1 | 100% | 100% | |
2 | human | 9203 | ZMYM3 | zinc finger MYM-type contai... | NM_001171162.1 | 36.3% | 36.1% | (many diffs) |
3 | human | 9203 | ZMYM3 | zinc finger MYM-type contai... | XM_005262310.3 | 36.3% | 36.1% | (many diffs) |
4 | human | 9203 | ZMYM3 | zinc finger MYM-type contai... | NM_005096.3 | 35.9% | 35.8% | (many diffs) |
5 | human | 9203 | ZMYM3 | zinc finger MYM-type contai... | NM_201599.3 | 35.9% | 35.8% | (many diffs) |
6 | human | 9203 | ZMYM3 | zinc finger MYM-type contai... | XM_005262309.4 | 35.9% | 35.8% | (many diffs) |
7 | human | 9203 | ZMYM3 | zinc finger MYM-type contai... | XM_011531062.3 | 35.9% | 35.8% | (many diffs) |
8 | mouse | 56364 | Zmym3 | zinc finger, MYM-type 3 | NM_001177986.1 | 91% | 90.7% | (many diffs) |
9 | mouse | 56364 | Zmym3 | zinc finger, MYM-type 3 | NM_001177987.1 | 83.8% | 83.5% | (many diffs) |
10 | mouse | 56364 | Zmym3 | zinc finger, MYM-type 3 | NM_001177988.1 | 63.6% | 48.1% | (many diffs) |
11 | mouse | 56364 | Zmym3 | zinc finger, MYM-type 3 | XM_006528171.3 | 63.6% | 48.1% | (many diffs) |
12 | mouse | 56364 | Zmym3 | zinc finger, MYM-type 3 | XM_030251426.1 | 63.6% | 48.1% | (many diffs) |
13 | mouse | 56364 | Zmym3 | zinc finger, MYM-type 3 | XM_030251427.1 | 63.6% | 48.1% | (many diffs) |
14 | mouse | 56364 | Zmym3 | zinc finger, MYM-type 3 | XM_006528170.2 | 58.5% | 44.5% | (many diffs) |
15 | mouse | 56364 | Zmym3 | zinc finger, MYM-type 3 | NM_001177985.1 | 35.3% | 35% | (many diffs) |
16 | mouse | 56364 | Zmym3 | zinc finger, MYM-type 3 | XM_011247650.3 | 32.9% | 32.7% | (many diffs) |
17 | mouse | 56364 | Zmym3 | zinc finger, MYM-type 3 | XM_011247651.3 | 32.9% | 32.7% | (many diffs) |
18 | mouse | 56364 | Zmym3 | zinc finger, MYM-type 3 | XM_030251412.1 | 32.9% | 32.7% | (many diffs) |
19 | mouse | 56364 | Zmym3 | zinc finger, MYM-type 3 | XM_030251413.1 | 32.9% | 32.7% | (many diffs) |
20 | mouse | 56364 | Zmym3 | zinc finger, MYM-type 3 | XM_030251414.1 | 32.9% | 32.7% | (many diffs) |
21 | mouse | 56364 | Zmym3 | zinc finger, MYM-type 3 | NM_019831.3 | 32.9% | 32.6% | (many diffs) |
22 | mouse | 56364 | Zmym3 | zinc finger, MYM-type 3 | XM_006528163.4 | 32.9% | 32.6% | (many diffs) |
23 | mouse | 56364 | Zmym3 | zinc finger, MYM-type 3 | XM_006528164.3 | 32.9% | 32.6% | (many diffs) |
24 | mouse | 56364 | Zmym3 | zinc finger, MYM-type 3 | XM_006528165.4 | 32.9% | 32.6% | (many diffs) |
25 | mouse | 56364 | Zmym3 | zinc finger, MYM-type 3 | XM_006528166.4 | 32.9% | 32.6% | (many diffs) |
26 | mouse | 56364 | Zmym3 | zinc finger, MYM-type 3 | XM_006528162.3 | 32.1% | 31.8% | (many diffs) |
27 | mouse | 56364 | Zmym3 | zinc finger, MYM-type 3 | XM_006528161.2 | 31.9% | 31.7% | (many diffs) |
28 | mouse | 56364 | Zmym3 | zinc finger, MYM-type 3 | XM_006528160.2 | 31.9% | 31.6% | (many diffs) |
29 | mouse | 56364 | Zmym3 | zinc finger, MYM-type 3 | XM_030251416.1 | 21.7% | 21.7% | (many diffs) |
30 | mouse | 56364 | Zmym3 | zinc finger, MYM-type 3 | XM_030251417.1 | 21.7% | 21.7% | (many diffs) |
31 | mouse | 56364 | Zmym3 | zinc finger, MYM-type 3 | XM_006528169.4 | 21.7% | 21.6% | (many diffs) |
32 | mouse | 56364 | Zmym3 | zinc finger, MYM-type 3 | XM_030251415.1 | 21.7% | 21.6% | (many diffs) |
33 | mouse | 56364 | Zmym3 | zinc finger, MYM-type 3 | XM_006528168.3 | 21% | 21% | (many diffs) |
34 | mouse | 56364 | Zmym3 | zinc finger, MYM-type 3 | XM_006528167.3 | 21% | 21% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1551
- ORF length:
- 1485
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgga ccccagtgat ttccccagtc catttgaccc attgaccctg ccagagaagc 121 ccctggctgg agacctacca gtagacatgg aatttggaga ggatctactg gaatcccaga 181 ctgccccaac tcgaggatgg gccccccctg gcccttctcc atcctcggga gccctggacc 241 tgcttgatac ccctgctggc ctggaaaaag accctggagt cctggatgga gccactgagt 301 tgctggggct gggggggctg ctctataaag ccccctctcc cccggaggtg gaccacggtc 361 ctgagggaac cctggcatgg gatgcaggag atcagaccct agagcctgga ccagggggcc 421 agacccctga ggtggtacca cctgatccag gggctggggc aaattcctgt tcacctgagg 481 ggctactaga gcctttggct ccagattctc caataacact gcagtcccca catattgaag 541 aggaggagac cacctccata gctactgcaa gaaggggctc ccctgggcag gaggaggagc 601 ttccccaagg gcagccacag agcccaaatg ccccgcctag cccttcagtg ggagagactc 661 tgggggatgg aatcaacagt tctcagacca aacctggggg ctctagcccc cctgcacatc 721 cttccttgcc aggagatggc ctgactgcga aggcgagtga gaagccgcct gaacggaaga 781 gaagcgagcg cgttaggaga gcagaacctc caaaacctga ggttgtagat tccactgaga 841 gcattccagt gtcagatgag gattctgatg ccatggtaga tgaccccaat gatgaggact 901 ttgtgccatt ccggccccgg cgctctcctc gcatgtccct acgctcaagt gtgtcacaaa 961 gggccgggcg ctctgcagtg ggcaccaaga tgacttgtgc acattgccgg acaccactgc 1021 agaaggggca gactgcctat cagcgcaagg ggctgcctca gctcttctgc tcgtcatcct 1081 gcctcaccac tttctccaag aagccctcgg gcaaaaagac ctgtaccttc tgcaagaagg 1141 agatctggaa caccaaggac tcggttgtgg cgcagactgg ttctggaggc tccttccatg 1201 agttctgcac atccgtctgt ctcTCCCTGT ATGAGGCCCA GCAGCAGCGC CCGATCCCCC 1261 AGTCTGGGGA TCCCGCCGAC GCTACTCGCT GCAGCATATG CCAGAAGACT GGAGAGGTCC 1321 TGCACGAGGT CAGCAATGGC AGCGTGGTAC ACCGGCTCTG CAGCGATTCT TGCTTCTCCA 1381 AATTCCGGGC CAACAAGGGA CTGAAAACCA ACTGTTGTGA CCAGTGTGGG GCTTACATCT 1441 ACACCAAGAC CGGGAGTCCT GGCCCTGAGC TCCTCTTCCA CGAGGGCCAA CAAAAGCGGT 1501 TCTGCAACAC AACCTGCTTG GGGGCGTACA AGAAGGTGGG GCCGAGGGAG TACCCAACTT 1561 TCTTGTACAA AGTGGTTGAT ATCGGTAAGC CTATCCCTAA CCCTCTCCTC GGTCTCGATT 1621 CTACGTAGTA ATGAACTAGT CCGTAACTTG AAAGTATTTC GATTTCTTGG CTTTATATAT 1681 CTTGTGGAAA GGACGAGCCC TCCTTGGGAC TTACACACTT ACGCGTTAAG TCgacaatca 1741 acctctggat tacaaaattt gtgaaagatt