Transcript: Mouse XM_030252617.1

PREDICTED: Mus musculus zinc finger protein 697 (Zfp697), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-08-08
Taxon:
Mus musculus (mouse)
Gene:
Zfp697 (242109)
Length:
19975
CDS:
14945..16654

Additional Resources:

NCBI RefSeq record:
XM_030252617.1
NBCI Gene record:
Zfp697 (242109)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_030252617.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000086401 CCGGCAACAAGCCTCACAAAT pLKO.1 16563 CDS 100% 13.200 9.240 N Zfp697 n/a
2 TRCN0000419414 GAAAGAGGAATGGGCTCTAAT pLKO_005 15050 CDS 100% 13.200 9.240 N Zfp697 n/a
3 TRCN0000424319 TTGCCCTAACACCTCACTTAT pLKO_005 17070 3UTR 100% 13.200 9.240 N Zfp697 n/a
4 TRCN0000086400 ACCCACAGGATGATGATCTAA pLKO.1 15120 CDS 100% 5.625 3.938 N Zfp697 n/a
5 TRCN0000086398 CGCTTGATAGAGGAGGAAGAT pLKO.1 15365 CDS 100% 4.950 3.465 N Zfp697 n/a
6 TRCN0000423577 TGGATTCTGACTTGGAGAACT pLKO_005 15003 CDS 100% 4.950 3.465 N Zfp697 n/a
7 TRCN0000431062 CATTGCCTACTCCCGTGCTTC pLKO_005 15387 CDS 100% 1.350 0.945 N Zfp697 n/a
8 TRCN0000422075 GAAGCGCTTCAGCGACTTCTC pLKO_005 16429 CDS 100% 1.350 0.945 N Zfp697 n/a
9 TRCN0000086402 TGTCAGAATCTGACAGCATAT pLKO.1 15276 CDS 100% 1.080 0.756 N Zfp697 n/a
10 TRCN0000427758 GAGAACTGAGATAGGTGATTT pLKO_005 16972 3UTR 100% 13.200 7.920 N Zfp697 n/a
11 TRCN0000430679 CAGAAGTTGCACTTGTGTTAG pLKO_005 16634 CDS 100% 10.800 6.480 N Zfp697 n/a
12 TRCN0000106535 GCCTGGTCTACAAAGTGAGTT pLKO.1 10304 5UTR 100% 4.950 2.475 Y Gad2 n/a
13 TRCN0000092881 GAGGAAGATGAAGAGGAGGAA pLKO.1 15314 CDS 100% 2.640 1.320 Y Gm4169 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_030252617.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.