Transcript: Mouse XM_030253418.1

PREDICTED: Mus musculus acyl-coenzyme A amino acid N-acyltransferase 1 (Acnat1), transcript variant X4, mRNA.

Source:
NCBI, updated 2019-08-08
Taxon:
Mus musculus (mouse)
Gene:
Acnat1 (230161)
Length:
6383
CDS:
1343..2593

Additional Resources:

NCBI RefSeq record:
XM_030253418.1
NBCI Gene record:
Acnat1 (230161)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_030253418.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000376308 TCTGATATGTTCCTGATAAAT pLKO_005 2828 3UTR 100% 15.000 10.500 N Acnat1 n/a
2 TRCN0000377186 TGGAATTGTTGTAGGGATAAA pLKO_005 2636 3UTR 100% 13.200 9.240 N Acnat1 n/a
3 TRCN0000367122 ATTGCCACGGTCTGCATAAAT pLKO_005 2096 CDS 100% 15.000 9.000 N Acnat1 n/a
4 TRCN0000367123 TTCCGTCACACTACACAATAT pLKO_005 2225 CDS 100% 13.200 7.920 N Acnat1 n/a
5 TRCN0000367185 GGTCCTTTCCCAGGAATTATT pLKO_005 1814 CDS 100% 15.000 7.500 Y Acnat1 n/a
6 TRCN0000367186 TCCGGAAGCAAACTCTAAATA pLKO_005 2576 CDS 100% 15.000 7.500 Y Acnat1 n/a
7 TRCN0000376309 ACCTCATAGAGCCACCTTATT pLKO_005 2418 CDS 100% 13.200 6.600 Y Acnat1 n/a
8 TRCN0000113204 CACCTCATAGAGCCACCTTAT pLKO.1 2417 CDS 100% 10.800 5.400 Y Acnat2 n/a
9 TRCN0000113202 CCAAGCCTTCTACAAGACTAA pLKO.1 1483 CDS 100% 4.950 2.475 Y Acnat2 n/a
10 TRCN0000113203 CCCAAGCCTTCTACAAGACTA pLKO.1 1482 CDS 100% 4.950 2.475 Y Acnat2 n/a
11 TRCN0000088138 GATTGGTGTAAGGTAGAATAT pLKO.1 4473 3UTR 100% 13.200 6.600 Y LOC433577 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_030253418.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.