Transcript: Mouse XM_030254682.1

PREDICTED: Mus musculus zinc finger protein 644 (Zfp644), transcript variant X32, mRNA.

Source:
NCBI, updated 2019-08-08
Taxon:
Mus musculus (mouse)
Gene:
Zfp644 (52397)
Length:
5981
CDS:
470..4486

Additional Resources:

NCBI RefSeq record:
XM_030254682.1
NBCI Gene record:
Zfp644 (52397)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_030254682.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000125211 CGTCACATTGTAAACGCTAAT pLKO.1 4358 CDS 100% 10.800 15.120 N Zfp644 n/a
2 TRCN0000125212 CGCCTGTGAAACGAGTTAGAA pLKO.1 3441 CDS 100% 5.625 7.875 N Zfp644 n/a
3 TRCN0000125213 CGAGATCGTAATTCACTACTA pLKO.1 1769 CDS 100% 4.950 6.930 N Zfp644 n/a
4 TRCN0000140402 GACGAGGTTTACATTCTCCGA pLKO.1 4268 CDS 100% 0.660 0.924 N ZNF644 n/a
5 TRCN0000140261 GTGCTGACGAGGTTTACATTC pLKO.1 4263 CDS 100% 10.800 7.560 N ZNF644 n/a
6 TRCN0000125209 CCTGGAAATTATTTGTGGTAA pLKO.1 5149 3UTR 100% 4.950 3.465 N Zfp644 n/a
7 TRCN0000125210 GCCCTGAGTTACGATCAGAAT pLKO.1 3101 CDS 100% 4.950 3.465 N Zfp644 n/a
8 TRCN0000140054 CAAGGTCAAGATCTGGAAGCA pLKO.1 4215 CDS 100% 2.640 1.848 N ZNF644 n/a
9 TRCN0000145032 GACTGGATTAAGCACTTACAA pLKO.1 4337 CDS 100% 5.625 3.938 N ZNF644 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_030254682.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09151 pDONR223 100% 81.7% 80.7% None (many diffs) n/a
2 ccsbBroad304_09151 pLX_304 0% 81.7% 80.7% V5 (many diffs) n/a
3 TRCN0000475663 TTTATGCATGAGACAATACTCATG pLX_317 7.9% 81.7% 80.7% V5 (many diffs) n/a
Download CSV