Transcript: Mouse XM_030254738.1

PREDICTED: Mus musculus GRB10 interacting GYF protein 1 (Gigyf1), transcript variant X10, mRNA.

Source:
NCBI, updated 2019-08-08
Taxon:
Mus musculus (mouse)
Gene:
Gigyf1 (57330)
Length:
5996
CDS:
634..3765

Additional Resources:

NCBI RefSeq record:
XM_030254738.1
NBCI Gene record:
Gigyf1 (57330)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_030254738.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000421422 TTCGACTCAGGGTCCAATTCT pLKO_005 2628 CDS 100% 5.625 7.875 N GIGYF1 n/a
2 TRCN0000177092 CTTACGATGTCCATGATTATA pLKO.1 3434 CDS 100% 15.000 12.000 N Gigyf1 n/a
3 TRCN0000340967 CTTACGATGTCCATGATTATA pLKO_005 3434 CDS 100% 15.000 12.000 N Gigyf1 n/a
4 TRCN0000340968 CTTCGACTCAGGGTCCAATTC pLKO_005 2627 CDS 100% 10.800 8.640 N Gigyf1 n/a
5 TRCN0000216088 CATGAATGTATTTCTAGTTTC pLKO.1 5206 3UTR 100% 10.800 7.560 N Gigyf1 n/a
6 TRCN0000167024 CCAAAGAATTTGCCAAACAAT pLKO.1 3485 CDS 100% 5.625 3.938 N GIGYF1 n/a
7 TRCN0000177701 CGATGGCTTTGAAGATGACAA pLKO.1 1470 CDS 100% 4.950 3.465 N Gigyf1 n/a
8 TRCN0000340966 CGATGGCTTTGAAGATGACAA pLKO_005 1470 CDS 100% 4.950 3.465 N Gigyf1 n/a
9 TRCN0000178394 GAACTACAGGACAAGGAGTTT pLKO.1 808 CDS 100% 4.950 3.465 N Gigyf1 n/a
10 TRCN0000340965 GAACTACAGGACAAGGAGTTT pLKO_005 808 CDS 100% 4.950 3.465 N Gigyf1 n/a
11 TRCN0000182148 CCAGTCTTTGGGACATACCAA pLKO.1 2600 CDS 100% 3.000 2.100 N Gigyf1 n/a
12 TRCN0000178451 GAATTGTTGCTGAAGCTGCTA pLKO.1 2833 CDS 100% 2.640 1.848 N Gigyf1 n/a
13 TRCN0000420791 CTTTGGGACATACCAATTAAC pLKO_005 2605 CDS 100% 13.200 7.920 N GIGYF1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_030254738.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.