Transcript: Mouse XM_030255232.1

PREDICTED: Mus musculus LUC7-like 2 (S. cerevisiae) (Luc7l2), transcript variant X14, mRNA.

Source:
NCBI, updated 2019-08-08
Taxon:
Mus musculus (mouse)
Gene:
Luc7l2 (192196)
Length:
3290
CDS:
648..1667

Additional Resources:

NCBI RefSeq record:
XM_030255232.1
NBCI Gene record:
Luc7l2 (192196)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_030255232.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000099566 GCACCTGGGATTTATTGAAAT pLKO.1 1130 CDS 100% 13.200 18.480 N Luc7l2 n/a
2 TRCN0000309132 GCACCTGGGATTTATTGAAAT pLKO_005 1130 CDS 100% 13.200 18.480 N Luc7l2 n/a
3 TRCN0000001191 CGGTCCTATGAGAGTGCTAAT pLKO.1 1593 CDS 100% 10.800 15.120 N LUC7L2 n/a
4 TRCN0000314556 CGGTCCTATGAGAGTGCTAAT pLKO_005 1593 CDS 100% 10.800 15.120 N LUC7L2 n/a
5 TRCN0000305209 GAAGTTTATCGGAACTCTATG pLKO_005 999 CDS 100% 10.800 15.120 N Luc7l2 n/a
6 TRCN0000099567 CGATCCAAGTCTCGTGAGAAA pLKO.1 1365 CDS 100% 4.950 6.930 N Luc7l2 n/a
7 TRCN0000099568 GATTATGAAATTGCGTCCAAA pLKO.1 696 CDS 100% 4.950 6.930 N Luc7l2 n/a
8 TRCN0000375719 TCTCGGGACGGAGATACTACT pLKO_005 493 5UTR 100% 4.950 6.930 N Luc7l2 n/a
9 TRCN0000099565 CCCAAATCTCTTGCTGCCTAT pLKO.1 2616 3UTR 100% 4.050 5.670 N Luc7l2 n/a
10 TRCN0000305265 CCCGATCACATAGCAAGAATC pLKO_005 1270 CDS 100% 10.800 7.560 N Luc7l2 n/a
11 TRCN0000375721 GAAGAATTAAAGAGAGTTGTA pLKO_005 1164 CDS 100% 4.950 3.465 N Luc7l2 n/a
12 TRCN0000099569 AGATTATGAAATTGCGTCCAA pLKO.1 695 CDS 100% 2.640 1.848 N Luc7l2 n/a
13 TRCN0000375720 TCCAGCTTCCAGCAGCAGAAA pLKO_005 1026 CDS 100% 4.950 2.970 N Luc7l2 n/a
14 TRCN0000001192 GCAGAGGAAGTTTATCGGAAT pLKO.1 993 CDS 100% 4.050 2.835 N LUC7L2 n/a
15 TRCN0000320722 GCAGAGGAAGTTTATCGGAAT pLKO_005 993 CDS 100% 4.050 2.835 N LUC7L2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_030255232.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03349 pDONR223 100% 81% 85.9% None (many diffs) n/a
2 ccsbBroad304_03349 pLX_304 0% 81% 85.9% V5 (many diffs) n/a
3 TRCN0000472615 TCCGGGGCCGATTCGTTAGCTGAC pLX_317 45.2% 81% 85.9% V5 (many diffs) n/a
Download CSV