Transcript: Human XR_001737008.1

PREDICTED: Homo sapiens helicase for meiosis 1 (HFM1), transcript variant X8, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
HFM1 (164045)
Length:
4784
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_001737008.1
NBCI Gene record:
HFM1 (164045)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_001737008.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000142022 GCATCGGATTCTCACTATGTT pLKO.1 3110 3UTR 100% 5.625 7.875 N HFM1 n/a
2 TRCN0000144506 CGGATAACTATCAGATTTCCA pLKO.1 2564 3UTR 100% 3.000 4.200 N HFM1 n/a
3 TRCN0000144620 GAACAAAGATCCAAATCGGAT pLKO.1 2548 3UTR 100% 2.640 3.696 N HFM1 n/a
4 TRCN0000139916 GCCCTTAAGTTAAGGGCTGAT pLKO.1 4483 3UTR 100% 0.405 0.567 N HFM1 n/a
5 TRCN0000144601 GAAGATTGATGGCTTGGTATT pLKO.1 2385 3UTR 100% 10.800 7.560 N HFM1 n/a
6 TRCN0000144491 CATCGGATTCTCACTATGTTA pLKO.1 3111 3UTR 100% 5.625 3.938 N HFM1 n/a
7 TRCN0000155884 CTCAGGAGTTAGAGGAAGAAT pLKO.1 186 3UTR 100% 5.625 3.938 N HFM1 n/a
8 TRCN0000145594 CTGATGATGAAGCTGATGAAA pLKO.1 4202 3UTR 100% 5.625 3.938 N HFM1 n/a
9 TRCN0000145285 GCAAGGGAACTTGAATTGATT pLKO.1 2924 3UTR 100% 5.625 3.938 N HFM1 n/a
10 TRCN0000144534 CCTAGTATATCAAGGTCAGAA pLKO.1 3698 3UTR 100% 4.950 3.465 N HFM1 n/a
11 TRCN0000154493 GCATGTTCAAAGCACCATCTT pLKO.1 744 3UTR 100% 4.950 3.465 N HFM1 n/a
12 TRCN0000154492 GATACTCAGGAGTTAGAGGAA pLKO.1 182 3UTR 100% 2.640 1.848 N HFM1 n/a
13 TRCN0000145513 GAAACAGGAATGCTGTTTCAT pLKO.1 3585 3UTR 100% 0.563 0.394 N HFM1 n/a
14 TRCN0000142697 CCCTTAAGTTAAGGGCTGATT pLKO.1 4484 3UTR 100% 0.495 0.347 N HFM1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_001737008.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13338 pDONR223 100% 29.3% None (many diffs) n/a
2 ccsbBroad304_13338 pLX_304 0% 29.3% V5 (many diffs) n/a
3 TRCN0000478713 TTGATCCCTTTGCTCACACAGTTT pLX_317 22.9% 29.3% V5 (many diffs) n/a
4 ccsbBroadEn_15274 pDONR223 91.1% 24.2% None (many diffs) n/a
5 ccsbBroad304_15274 pLX_304 0% 24.2% V5 (not translated due to prior stop codon) (many diffs) n/a
6 TRCN0000475533 GGCCTGTGTCTGACCATTGCGCAA pLX_317 1.5% 24.2% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV