Transcript: Human XR_001737014.1

PREDICTED: Homo sapiens dihydropyrimidine dehydrogenase (DPYD), transcript variant X7, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
DPYD (1806)
Length:
778
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_001737014.1
NBCI Gene record:
DPYD (1806)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_001737014.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000427194 ACTGAAGAGGGACCCATTAAT pLKO_005 570 3UTR 100% 15.000 21.000 N DPYD n/a
2 TRCN0000221382 GCTGTCCAACTAATCTTGATA pLKO.1 406 3UTR 100% 5.625 7.875 N DPYD n/a
3 TRCN0000433515 GTGTAGGTGGATGCAATTTAT pLKO_005 544 3UTR 100% 15.000 10.500 N DPYD n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_001737014.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00459 pDONR223 100% 66.7% None 1_137del;657_778del n/a
2 ccsbBroad304_00459 pLX_304 0% 66.7% V5 1_137del;657_778del n/a
3 TRCN0000475366 GACCTTCGACGGTTGATCCGTAAA pLX_317 19.8% 66.7% V5 1_137del;657_778del n/a
Download CSV