Transcript: Human XR_001737187.2

PREDICTED: Homo sapiens Mov10 RISC complex RNA helicase (MOV10), transcript variant X9, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
MOV10 (4343)
Length:
3532
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_001737187.2
NBCI Gene record:
MOV10 (4343)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_001737187.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000419396 ACGTTAGTGGAGGCAATTAAG pLKO_005 1713 3UTR 100% 13.200 18.480 N MOV10 n/a
2 TRCN0000425452 GGCCAGTGTTTCGAGAGTTTC pLKO_005 156 3UTR 100% 10.800 15.120 N MOV10 n/a
3 TRCN0000049978 CGCGACTTCAAGATCAGCTTT pLKO.1 237 3UTR 100% 4.950 6.930 N MOV10 n/a
4 TRCN0000049980 CCATCATCTTTCACGGCGTAA pLKO.1 2440 3UTR 100% 4.050 5.670 N MOV10 n/a
5 TRCN0000049979 CCCATCACATATAAGGGCTTT pLKO.1 1344 3UTR 100% 4.050 5.670 N MOV10 n/a
6 TRCN0000049982 CGTTACTGCATCACCAAACTT pLKO.1 2637 3UTR 100% 5.625 4.500 N MOV10 n/a
7 TRCN0000049981 GCTGACCTTCAAGGTGAACTT pLKO.1 1436 3UTR 100% 4.950 3.465 N MOV10 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_001737187.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01030 pDONR223 100% 85.1% None 1_116del;2698_2874del;3303_3532del n/a
Download CSV