Transcript: Human XR_001737295.1

PREDICTED: Homo sapiens NECAP endocytosis associated 2 (NECAP2), transcript variant X2, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
NECAP2 (55707)
Length:
2135
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_001737295.1
NBCI Gene record:
NECAP2 (55707)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_001737295.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000165698 CGGGCATGTTTGGCAGTAAAT pLKO.1 1092 3UTR 100% 13.200 18.480 N NECAP2 n/a
2 TRCN0000275234 CGGGCATGTTTGGCAGTAAAT pLKO_005 1092 3UTR 100% 13.200 18.480 N NECAP2 n/a
3 TRCN0000275240 GACGGGCGTTTATTGGAATTG pLKO_005 340 3UTR 100% 10.800 15.120 N NECAP2 n/a
4 TRCN0000275233 ACGGATTCCAGCAGGTACTTC pLKO_005 291 3UTR 100% 4.950 6.930 N NECAP2 n/a
5 TRCN0000165062 GATCCGCATCGAAGATGGAAA pLKO.1 314 3UTR 100% 4.950 3.960 N NECAP2 n/a
6 TRCN0000161268 GATGCCTTTGACTTCAATGTT pLKO.1 378 3UTR 100% 5.625 3.938 N NECAP2 n/a
7 TRCN0000275235 CCAAATCTACAGGATCAACTT pLKO_005 886 3UTR 100% 4.950 3.465 N NECAP2 n/a
8 TRCN0000166462 CCAGACCATCAAGCTCAACAT pLKO.1 503 3UTR 100% 4.950 3.465 N NECAP2 n/a
9 TRCN0000166290 CAATGTTGCATTGCAGGACCA pLKO.1 392 3UTR 100% 2.160 1.512 N NECAP2 n/a
10 TRCN0000163018 GACCATTTCAAGTGGGTGAAA pLKO.1 408 3UTR 100% 0.495 0.297 N NECAP2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_001737295.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03634 pDONR223 100% 36.9% None 1_38del;528_644del;945_2135del n/a
2 ccsbBroad304_03634 pLX_304 0% 36.9% V5 1_38del;528_644del;945_2135del n/a
3 TRCN0000478327 GTCCGCCCACGATCCGTCAGTCTC pLX_317 48.9% 36.9% V5 1_38del;528_644del;945_2135del n/a
Download CSV