Transcript: Human XR_001737319.1

PREDICTED: Homo sapiens presenilin 2 (PSEN2), transcript variant X8, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
PSEN2 (5664)
Length:
2929
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_001737319.1
NBCI Gene record:
PSEN2 (5664)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_001737319.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000440874 CATCACGTTCGGGCTCATCTT pLKO_005 2315 3UTR 100% 4.950 6.930 N PSEN2 n/a
2 TRCN0000073744 CGTGGTTATGACCATCTTCTT pLKO.1 1195 3UTR 100% 4.950 6.930 N PSEN2 n/a
3 TRCN0000285918 TACACTCTAGTGCCATATATT pLKO_005 2470 3UTR 100% 15.000 10.500 N Psen2 n/a
4 TRCN0000073745 GCTGTTCCTCTTCACCTATAT pLKO.1 1285 3UTR 100% 13.200 9.240 N PSEN2 n/a
5 TRCN0000421470 TGAACTGAGAAGGTCAGATTA pLKO_005 2651 3UTR 100% 13.200 9.240 N PSEN2 n/a
6 TRCN0000425686 TCTGAGAATGCTGGTAGAAAC pLKO_005 1567 3UTR 100% 10.800 7.560 N PSEN2 n/a
7 TRCN0000437834 CAGCTCATCTACACGCCATTC pLKO_005 1100 3UTR 100% 6.000 4.200 N PSEN2 n/a
8 TRCN0000416225 ATCAAGTCTGTGCGCTTCTAC pLKO_005 1064 3UTR 100% 4.950 3.465 N PSEN2 n/a
9 TRCN0000431458 ATCCATGGCTGGTTGATCATG pLKO_005 1250 3UTR 100% 4.950 3.465 N PSEN2 n/a
10 TRCN0000073746 CATCGTGGTTATGACCATCTT pLKO.1 1192 3UTR 100% 4.950 3.465 N PSEN2 n/a
11 TRCN0000073743 GCTGTTTCATCACCAGACTTT pLKO.1 2570 3UTR 100% 4.950 3.465 N PSEN2 n/a
12 TRCN0000073747 CCTCATCATGATCAGCGTCAT pLKO.1 1174 3UTR 100% 4.050 2.835 N PSEN2 n/a
13 TRCN0000030527 GAGAGAAATGAGCCCATATTT pLKO.1 1595 3UTR 100% 15.000 9.000 N Psen2 n/a
14 TRCN0000320217 GAGAGAAATGAGCCCATATTT pLKO_005 1595 3UTR 100% 15.000 9.000 N Psen2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_001737319.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06789 pDONR223 100% 45.7% None (many diffs) n/a
2 ccsbBroad304_06789 pLX_304 0% 45.7% V5 (many diffs) n/a
3 TRCN0000492347 ACTATACCAGCGTTGCGTCAAACC pLX_317 29.3% 45.7% V5 (many diffs) n/a
Download CSV