Transcript: Human XR_001737362.1

PREDICTED: Homo sapiens mitochondrial amidoxime reducing component 1 (MARC1), transcript variant X3, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
MTARC1 (64757)
Length:
1236
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_001737362.1
NBCI Gene record:
MTARC1 (64757)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_001737362.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000122672 GCCTACACAAAGGACCTACTA pLKO.1 633 3UTR 100% 4.950 6.930 N MTARC1 n/a
2 TRCN0000139078 CCACAAATGCAGTGCACAAGT pLKO.1 673 3UTR 100% 4.950 3.465 N MTARC1 n/a
3 TRCN0000139302 CACCACAAATGCAGTGCACAA pLKO.1 671 3UTR 100% 4.050 2.835 N MTARC1 n/a
4 TRCN0000139782 CCAGCCCATTCTTGATCCTTT pLKO.1 877 3UTR 100% 4.950 2.970 N MTARC1 n/a
5 TRCN0000139028 CTCTGGATCTACCCTGTGAAA pLKO.1 429 3UTR 100% 4.950 2.970 N MTARC1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_001737362.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08864 pDONR223 100% 67.3% None (many diffs) n/a
2 ccsbBroad304_08864 pLX_304 0% 67.3% V5 (many diffs) n/a
3 TRCN0000476718 TAATATAACGCCTCGTATCTGATT pLX_317 36% 67.3% V5 (many diffs) n/a
Download CSV