Transcript: Human XR_001737452.1

PREDICTED: Homo sapiens cyclin L2 (CCNL2), transcript variant X10, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
CCNL2 (81669)
Length:
4267
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_001737452.1
NBCI Gene record:
CCNL2 (81669)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_001737452.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000045240 CTTGCAGCTTTATGCTCGGAA pLKO.1 2808 3UTR 100% 2.640 2.112 N CCNL2 n/a
2 TRCN0000045239 CCCTACAAAGGCTCTGAGATT pLKO.1 3277 3UTR 100% 4.950 3.465 N CCNL2 n/a
3 TRCN0000045242 GCGTCTCCTAAGAGGAGGAAA pLKO.1 3163 3UTR 100% 4.950 2.970 N CCNL2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_001737452.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09080 pDONR223 100% 15.8% None 1_30del;242C>G;709_4267del n/a
2 ccsbBroad304_09080 pLX_304 0% 15.8% V5 1_30del;242C>G;709_4267del n/a
3 TRCN0000467606 CAAACTCTCTAGTTGACCTGGGCT pLX_317 60.3% 15.8% V5 1_30del;242C>G;709_4267del n/a
Download CSV