Transcript: Human XR_001737548.2

PREDICTED: Homo sapiens ADAM metallopeptidase with thrombospondin type 1 motif 4 (ADAMTS4), transcript variant X2, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ADAMTS4 (9507)
Length:
5660
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_001737548.2
NBCI Gene record:
ADAMTS4 (9507)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_001737548.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000377639 TGTTAGGCGTGTTACAATATC pLKO_005 4158 3UTR 100% 13.200 9.240 N ADAMTS4 n/a
2 TRCN0000062261 AGATGACAAGATGGCCGCATT pLKO.1 4390 3UTR 100% 4.050 2.835 N ADAMTS4 n/a
3 TRCN0000062258 CAGGAAATTCAGGTACGGATA pLKO.1 5612 3UTR 100% 4.050 2.835 N ADAMTS4 n/a
4 TRCN0000062259 CATCAGTTTGAATGGGCCTTT pLKO.1 4843 3UTR 100% 4.050 2.835 N ADAMTS4 n/a
5 TRCN0000062262 CGTGTTTCCAGAGAAGCTCAA pLKO.1 3895 3UTR 100% 4.050 2.835 N ADAMTS4 n/a
6 TRCN0000032006 GACCACTTTGACACAGCCATT pLKO.1 4634 3UTR 100% 4.050 2.835 N Adamts4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_001737548.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11377 pDONR223 100% 17.6% None (many diffs) n/a
2 ccsbBroad304_11377 pLX_304 0% 17.6% V5 (many diffs) n/a
3 TRCN0000474754 AGAGATTATCGATATAAAGGTTCC pLX_317 41.6% 17.6% V5 (many diffs) n/a
Download CSV