Transcript: Human XR_001737551.2

PREDICTED: Homo sapiens phosphodiesterase 4D interacting protein (PDE4DIP), transcript variant X10, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
PDE4DIP (9659)
Length:
8036
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_001737551.2
NBCI Gene record:
PDE4DIP (9659)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_001737551.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

No results found.

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_001737551.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07462 pDONR223 100% 42.2% None 1_407del;3803_8036delinsA n/a
2 ccsbBroad304_07462 pLX_304 0% 42.2% V5 1_407del;3803_8036delinsA n/a
3 TRCN0000473671 ATACATCCAACTTCAGTAGTATCG pLX_317 9.4% 42.2% V5 1_407del;3803_8036delinsA n/a
Download CSV