Transcript: Human XR_001738660.1

PREDICTED: Homo sapiens E2F transcription factor 6 (E2F6), transcript variant X4, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
E2F6 (1876)
Length:
3214
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_001738660.1
NBCI Gene record:
E2F6 (1876)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_001738660.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000013819 GCTGGTTTATTTAACTCGAAA pLKO.1 483 3UTR 100% 4.950 6.930 N E2F6 n/a
2 TRCN0000235085 TTGATGTATCGCTGGTTTATT pLKO_005 473 3UTR 100% 15.000 10.500 N E2F6 n/a
3 TRCN0000013821 AGAGTGTATGACATCACCAAT pLKO.1 586 3UTR 100% 4.950 2.970 N E2F6 n/a
4 TRCN0000013822 CGATGTCTATTTGTGTGAAGT pLKO.1 979 3UTR 100% 4.950 2.970 N E2F6 n/a
5 TRCN0000235089 ATAGATGTACACACGAATTTA pLKO_005 1542 3UTR 100% 15.000 7.500 Y E2F6 n/a
6 TRCN0000235088 ACGGACCTATCGATGTCTATT pLKO_005 969 3UTR 100% 13.200 6.600 Y E2F6 n/a
7 TRCN0000013820 AGGAGGAACTTTCTGACTTAT pLKO.1 713 3UTR 100% 13.200 6.600 Y E2F6 n/a
8 TRCN0000013818 CCACTTAGATTACTGAGTAAT pLKO.1 1286 3UTR 100% 13.200 6.600 Y E2F6 n/a
9 TRCN0000235086 GAAATCCAAGAACCATATTAG pLKO_005 636 3UTR 100% 13.200 6.600 Y E2F6 n/a
10 TRCN0000235087 TCCATGAACAGATCGTCATTG pLKO_005 863 3UTR 100% 10.800 5.400 Y E2F6 n/a
11 TRCN0000018202 CCAGCAGAAACCAGATTGGAT pLKO.1 895 3UTR 100% 3.000 1.500 Y LOC388861 n/a
12 TRCN0000018201 GCAATGGAAGATGCTTTGGAT pLKO.1 736 3UTR 100% 3.000 1.500 Y LOC388861 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_001738660.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00471 pDONR223 100% 26.2% None 1_282del;934_937delGTAG;1130_3214del n/a
2 ccsbBroad304_00471 pLX_304 0% 26.2% V5 1_282del;934_937delGTAG;1130_3214del n/a
3 TRCN0000473822 GAGAAGAATGCTGTACAACCTTGA pLX_317 57.5% 26.2% V5 1_282del;934_937delGTAG;1130_3214del n/a
Download CSV