Transcript: Human XR_001738995.2

PREDICTED: Homo sapiens zinc finger CCCH-type containing 8 (ZC3H8), transcript variant X5, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ZC3H8 (84524)
Length:
2584
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_001738995.2
NBCI Gene record:
ZC3H8 (84524)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_001738995.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000160217 CATTGGTAGATGGACCATAAA pLKO.1 1540 3UTR 100% 13.200 18.480 N ZC3H8 n/a
2 TRCN0000275515 CATTGGTAGATGGACCATAAA pLKO_005 1540 3UTR 100% 13.200 18.480 N ZC3H8 n/a
3 TRCN0000275517 TAAACTGGAGTGCGAGCAAAT pLKO_005 185 3UTR 100% 10.800 8.640 N ZC3H8 n/a
4 TRCN0000275516 CCTGGAAACAAAGGATCAAAT pLKO_005 510 3UTR 100% 13.200 9.240 N ZC3H8 n/a
5 TRCN0000275580 CACAAGAATTGTTGGCTAAAG pLKO_005 883 3UTR 100% 10.800 7.560 N ZC3H8 n/a
6 TRCN0000160611 CAAGAATTGTTGGCTAAAGTT pLKO.1 885 3UTR 100% 5.625 3.938 N ZC3H8 n/a
7 TRCN0000160243 CCTGAAGAATCTACAAAGAAA pLKO.1 384 3UTR 100% 5.625 3.938 N ZC3H8 n/a
8 TRCN0000275578 CCTGAAGAATCTACAAAGAAA pLKO_005 384 3UTR 100% 5.625 3.938 N ZC3H8 n/a
9 TRCN0000158431 CCTCTTCTGATTGATTGGATT pLKO.1 1431 3UTR 100% 4.950 3.465 N ZC3H8 n/a
10 TRCN0000163082 GCAGCATTTGAGTCAGGCATT pLKO.1 587 3UTR 100% 4.050 2.835 N ZC3H8 n/a
11 TRCN0000163399 GCTGGTCACAAGAATGGCAAA pLKO.1 459 3UTR 100% 4.050 2.835 N ZC3H8 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_001738995.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12827 pDONR223 100% 33.6% None (many diffs) n/a
2 ccsbBroad304_12827 pLX_304 0% 33.6% V5 (many diffs) n/a
3 TRCN0000474391 TTATCCGCGACACGCCTTGTATCT pLX_317 63.1% 33.6% V5 (many diffs) n/a
Download CSV