Transcript: Human XR_001739031.1

PREDICTED: Homo sapiens SEC14 and spectrin domain containing 1 (SESTD1), transcript variant X4, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
SESTD1 (91404)
Length:
9592
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_001739031.1
NBCI Gene record:
SESTD1 (91404)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_001739031.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000244162 ATTACAGCAGCGTCGATTTAA pLKO_005 682 3UTR 100% 15.000 21.000 N SESTD1 n/a
2 TRCN0000244164 CAACAAATTGACTCGTTATAT pLKO_005 412 3UTR 100% 15.000 21.000 N SESTD1 n/a
3 TRCN0000217520 GAATTACAGCAGCGTCGATTT pLKO.1 680 3UTR 100% 10.800 15.120 N Sestd1 n/a
4 TRCN0000217424 GACTTGGCTTTGAGGTTATTT pLKO.1 381 3UTR 100% 15.000 10.500 N Sestd1 n/a
5 TRCN0000244161 GACTTGGCTTTGAGGTTATTT pLKO_005 381 3UTR 100% 15.000 10.500 N SESTD1 n/a
6 TRCN0000244163 GCTACTACCAAGGCATAATTA pLKO_005 2362 3UTR 100% 15.000 10.500 N SESTD1 n/a
7 TRCN0000244165 GGTAGATGTGCGAAGGTTAAA pLKO_005 1480 3UTR 100% 13.200 9.240 N SESTD1 n/a
8 TRCN0000167690 GATTAACTGTTCCAGTAGTTT pLKO.1 2050 3UTR 100% 5.625 3.938 N SESTD1 n/a
9 TRCN0000172629 GCTGAGTGTCACCTTAGACTT pLKO.1 151 3UTR 100% 4.950 3.465 N SESTD1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_001739031.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09314 pDONR223 100% 21.7% None (many diffs) n/a
2 ccsbBroad304_09314 pLX_304 0% 21.7% V5 (many diffs) n/a
Download CSV