Transcript: Human XR_001739989.1

PREDICTED: Homo sapiens nischarin (NISCH), transcript variant X1, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
NISCH (11188)
Length:
4854
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_001739989.1
NBCI Gene record:
NISCH (11188)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_001739989.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000256839 ACTCTAGTCGCGTCAAGTTTA pLKO_005 3685 3UTR 100% 13.200 18.480 N NISCH n/a
2 TRCN0000256841 TGCCGTTCGACCTATCAATAT pLKO_005 665 3UTR 100% 13.200 18.480 N NISCH n/a
3 TRCN0000256842 CTGTCGCCTTAAGTACCTTAA pLKO_005 591 3UTR 100% 10.800 15.120 N NISCH n/a
4 TRCN0000583848 CCTCTCTAACCAAGGAATCAT pLKO_005 1554 3UTR 100% 5.625 7.875 N NISCH n/a
5 TRCN0000583926 CTGAAGGCACAACCCTAGAAG pLKO_005 848 3UTR 100% 4.950 6.930 N NISCH n/a
6 TRCN0000256840 ACAGGCAGCTTCCGATGATTT pLKO_005 1689 3UTR 100% 13.200 10.560 N NISCH n/a
7 TRCN0000256843 CTGTTGTGGGACCGTTGTTAA pLKO_005 4525 3UTR 100% 13.200 9.240 N NISCH n/a
8 TRCN0000163146 GCTGAGAACCGCTACTTTGAA pLKO.1 1987 3UTR 100% 5.625 3.938 N NISCH n/a
9 TRCN0000162969 GCCTGTTGACAAGGACTTCTA pLKO.1 3611 3UTR 100% 4.950 3.465 N NISCH n/a
10 TRCN0000161240 GTGGAGATAAGTCACTGTGAT pLKO.1 703 3UTR 100% 4.950 3.465 N NISCH n/a
11 TRCN0000163059 CCAGGGATGTTCTGATTCCTT pLKO.1 1650 3UTR 100% 3.000 2.100 N NISCH n/a
12 TRCN0000162883 GCACCTGTATAACCTTGTGCA pLKO.1 1026 3UTR 100% 2.640 1.848 N NISCH n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_001739989.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07768 pDONR223 100% 82.1% None (many diffs) n/a
2 ccsbBroad304_07768 pLX_304 0% 82.1% V5 (many diffs) n/a
3 TRCN0000476629 CCAAAACAGGGGTCACAGGAATCA pLX_317 8.3% 82.1% V5 (many diffs) n/a
Download CSV