Transcript: Human XR_001740162.1

PREDICTED: Homo sapiens ssu-2 homolog (SSUH2), transcript variant X13, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
SSUH2 (51066)
Length:
6221
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_001740162.1
NBCI Gene record:
SSUH2 (51066)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_001740162.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000121882 GCATTGGACAATCACATACAA pLKO.1 5838 3UTR 100% 5.625 3.938 N SSUH2 n/a
2 TRCN0000121580 CCAAGGAAAGACTTATGTCTA pLKO.1 5654 3UTR 100% 4.950 3.465 N SSUH2 n/a
3 TRCN0000142676 CTCTGGGACATCAAGGTTCAA pLKO.1 4967 3UTR 100% 4.950 3.465 N SSUH2 n/a
4 TRCN0000143338 GAAGAAGCTGTTGCACTTCAT pLKO.1 5254 3UTR 100% 4.950 3.465 N SSUH2 n/a
5 TRCN0000141894 GCACTTCATCCAGCTTGTCAT pLKO.1 5266 3UTR 100% 4.950 3.465 N SSUH2 n/a
6 TRCN0000142308 GTGTTCACTGTTGGCTGCATT pLKO.1 5822 3UTR 100% 4.950 3.465 N SSUH2 n/a
7 TRCN0000143758 CTTGCTAAAGCCAAAGGAGAA pLKO.1 5351 3UTR 100% 4.050 2.835 N SSUH2 n/a
8 TRCN0000144515 CACAGAAGTTCACTATTGGTA pLKO.1 5633 3UTR 100% 3.000 2.100 N SSUH2 n/a
9 TRCN0000145221 GAAGTTCACTATTGGTACCAA pLKO.1 5637 3UTR 100% 0.000 0.000 N SSUH2 n/a
10 TRCN0000141252 CCTCAGCTTTGTGGACTCTAA pLKO.1 4774 3UTR 100% 4.950 2.970 N SSUH2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_001740162.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14133 pDONR223 100% 14.5% None (many diffs) n/a
2 ccsbBroad304_14133 pLX_304 0% 14.5% V5 (many diffs) n/a
3 TRCN0000470481 GACTAAGTTATTCCCTTTCAAGCG pLX_317 41% 14.5% V5 (many diffs) n/a
Download CSV