Transcript: Human XR_001740177.2

PREDICTED: Homo sapiens plexin B1 (PLXNB1), transcript variant X10, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
PLXNB1 (5364)
Length:
11143
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_001740177.2
NBCI Gene record:
PLXNB1 (5364)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_001740177.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000236582 CATGCTCTTTCGAGGGATTAA pLKO_005 9054 3UTR 100% 13.200 18.480 N PLXNB1 n/a
2 TRCN0000236585 CGACGTGCAAACATCTGATAA pLKO_005 9921 3UTR 100% 13.200 18.480 N PLXNB1 n/a
3 TRCN0000236584 CTGCCACATCCTAGGTCTAAG pLKO_005 10952 3UTR 100% 10.800 15.120 N PLXNB1 n/a
4 TRCN0000061533 CGTGCAAACATCTGATAACAT pLKO.1 9924 3UTR 100% 5.625 7.875 N PLXNB1 n/a
5 TRCN0000061537 GTGGCCTACATCGAGTATGAT pLKO.1 4987 3UTR 100% 5.625 7.875 N PLXNB1 n/a
6 TRCN0000236586 CATGGGAAGCTTGAGTATTTC pLKO_005 8866 3UTR 100% 13.200 9.240 N PLXNB1 n/a
7 TRCN0000236583 TCAGTGGAGGACGTGAGATAT pLKO_005 7721 3UTR 100% 13.200 9.240 N PLXNB1 n/a
8 TRCN0000061535 CCCGATCAACAAACTTCTGTA pLKO.1 10023 3UTR 100% 4.950 3.465 N PLXNB1 n/a
9 TRCN0000061534 GCTTGAGTATTTCACTGACAT pLKO.1 8874 3UTR 100% 4.950 3.465 N PLXNB1 n/a
10 TRCN0000061536 CCAACTGCATTCACTCCCAAT pLKO.1 4003 3UTR 100% 4.050 2.835 N PLXNB1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_001740177.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11036 pDONR223 100% 2.2% None (many diffs) n/a
2 ccsbBroad304_11036 pLX_304 0% 2.2% V5 (many diffs) n/a
Download CSV