Transcript: Human XR_001740319.2

PREDICTED: Homo sapiens ADP ribosylation factor like GTPase 6 (ARL6), transcript variant X6, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ARL6 (84100)
Length:
3478
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_001740319.2
NBCI Gene record:
ARL6 (84100)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_001740319.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000047993 CGACGATCATTAACAAACTTA pLKO.1 2516 3UTR 100% 5.625 7.875 N ARL6 n/a
2 TRCN0000047996 CCCTGGCATATTTGTGCTAGT pLKO.1 2890 3UTR 100% 4.050 5.670 N ARL6 n/a
3 TRCN0000047994 CCGTCGAATTCCAATCTTATT pLKO.1 2784 3UTR 100% 0.000 0.000 N ARL6 n/a
4 TRCN0000047997 GATATTAAACACCGTCGAATT pLKO.1 2773 3UTR 100% 0.000 0.000 N ARL6 n/a
5 TRCN0000047995 CCAACAATAGGATTCAGCATA pLKO.1 2569 3UTR 100% 4.950 3.465 N ARL6 n/a
6 TRCN0000380136 TTTCAATTCAAGGAATCTATC pLKO_005 3230 3UTR 100% 10.800 6.480 N ARL6 n/a
7 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 73 3UTR 100% 5.625 2.813 Y KLHL30 n/a
8 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 73 3UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_001740319.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04329 pDONR223 100% 15.8% None (many diffs) n/a
2 ccsbBroad304_04329 pLX_304 0% 15.8% V5 (many diffs) n/a
3 TRCN0000474513 TAATCCGACGAAGATGCCAAACAC pLX_317 91.8% 15.8% V5 (many diffs) n/a
Download CSV