Transcript: Human XR_001741092.1

PREDICTED: Homo sapiens tetraspanin 5 (TSPAN5), transcript variant X3, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
TSPAN5 (10098)
Length:
3186
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_001741092.1
NBCI Gene record:
TSPAN5 (10098)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_001741092.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000229389 ATATCGGGATGACATTGATTT pLKO_005 687 3UTR 100% 13.200 18.480 N TSPAN5 n/a
2 TRCN0000119203 CCGGAGTTCTAGCATTTGTTT pLKO.1 611 3UTR 100% 5.625 7.875 N TSPAN5 n/a
3 TRCN0000119204 GCCCAGAATTTGGTTAGCGAT pLKO.1 984 3UTR 100% 2.640 3.696 N TSPAN5 n/a
4 TRCN0000229388 ACTGCCGGAGTTCTAGCATTT pLKO_005 607 3UTR 100% 10.800 8.640 N TSPAN5 n/a
5 TRCN0000229391 TTCGAGCTGCATGGACCTAAT pLKO_005 1105 3UTR 100% 10.800 8.640 N TSPAN5 n/a
6 TRCN0000094998 AGTCAGTTGTTGCATCAAATA pLKO.1 465 3UTR 100% 13.200 9.240 N Tspan5 n/a
7 TRCN0000119202 GAACTGATCTTCGAGCTGCAT pLKO.1 1096 3UTR 100% 2.640 1.848 N TSPAN5 n/a
8 TRCN0000119206 GCAGATTGTAATCTACACGAA pLKO.1 860 3UTR 100% 2.640 1.848 N TSPAN5 n/a
9 TRCN0000218149 TAGACTTCACCCAGGAATATT pLKO_005 719 3UTR 100% 15.000 10.500 N TSPAN5 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_001741092.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02314 pDONR223 100% 17.4% None (many diffs) n/a
2 ccsbBroad304_02314 pLX_304 0% 17.4% V5 (many diffs) n/a
3 TRCN0000468718 ACGTGCATACCCAGCACTGCTTTA pLX_317 41.7% 17.4% V5 (many diffs) n/a
Download CSV