Transcript: Human XR_001741095.2

PREDICTED: Homo sapiens solute carrier family 30 member 9 (SLC30A9), transcript variant X2, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
SLC30A9 (10463)
Length:
3330
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_001741095.2
NBCI Gene record:
SLC30A9 (10463)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_001741095.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000330038 AGTCGTGATCCTAGTACAAAT pLKO_005 1368 3UTR 100% 13.200 18.480 N SLC30A9 n/a
2 TRCN0000019929 GCGCTATATTTCTTCGCTAAT pLKO.1 1065 3UTR 100% 10.800 15.120 N SLC30A9 n/a
3 TRCN0000019932 GCGAGTTGTTACAAGATCATA pLKO.1 1709 3UTR 100% 5.625 7.875 N SLC30A9 n/a
4 TRCN0000019933 CCTTACTTCTATAACAGGCAA pLKO.1 1451 3UTR 100% 2.640 3.696 N SLC30A9 n/a
5 TRCN0000330036 CCCTGTAGTCATCCATATATT pLKO_005 304 3UTR 100% 15.000 10.500 N SLC30A9 n/a
6 TRCN0000330110 GCTATATTTCTTCGCTAATTA pLKO_005 1067 3UTR 100% 15.000 10.500 N SLC30A9 n/a
7 TRCN0000330113 TGTTCATAATGTCCCATATTT pLKO_005 2189 3UTR 100% 15.000 10.500 N SLC30A9 n/a
8 TRCN0000330037 CGAGTTGTTACAAGATCATAT pLKO_005 1710 3UTR 100% 13.200 9.240 N SLC30A9 n/a
9 TRCN0000019930 GCAGGATCATTAGTATCTGAA pLKO.1 1198 3UTR 100% 4.950 3.465 N SLC30A9 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_001741095.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07614 pDONR223 100% 51% None (many diffs) n/a
2 ccsbBroad304_07614 pLX_304 0% 51% V5 (many diffs) n/a
Download CSV