Transcript: Human XR_001741221.1

PREDICTED: Homo sapiens microsomal glutathione S-transferase 2 (MGST2), transcript variant X7, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
MGST2 (4258)
Length:
1464
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_001741221.1
NBCI Gene record:
MGST2 (4258)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_001741221.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000152420 CATATATGGCCGTCACCTATA pLKO.1 482 3UTR 100% 10.800 15.120 N MGST2 n/a
2 TRCN0000278432 CATATATGGCCGTCACCTATA pLKO_005 482 3UTR 100% 10.800 15.120 N MGST2 n/a
3 TRCN0000152555 GCAAGTTGGAAAGGCAAGATT pLKO.1 367 3UTR 100% 5.625 3.938 N MGST2 n/a
4 TRCN0000278430 GCAAGTTGGAAAGGCAAGATT pLKO_005 367 3UTR 100% 5.625 3.938 N MGST2 n/a
5 TRCN0000150912 GATGAATATCTGGACCTCAAT pLKO.1 618 3UTR 100% 4.950 3.465 N MGST2 n/a
6 TRCN0000297455 GATGAATATCTGGACCTCAAT pLKO_005 618 3UTR 100% 4.950 3.465 N MGST2 n/a
7 TRCN0000152898 GCAAACAGCTTTCTGGATGAA pLKO.1 603 3UTR 100% 4.950 3.465 N MGST2 n/a
8 TRCN0000155842 CCTGGGAATTGCAAACAGCTT pLKO.1 593 3UTR 100% 2.640 1.848 N MGST2 n/a
9 TRCN0000352900 CCTGGGAATTGCAAACAGCTT pLKO_005 593 3UTR 100% 2.640 1.848 N MGST2 n/a
10 TRCN0000155332 GAGAGAGTATTTCGGGCACAA pLKO.1 434 3UTR 100% 4.050 3.240 N MGST2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_001741221.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01010 pDONR223 100% 24.1% None 1_295del;453_454ins71;666_1464del n/a
2 ccsbBroad304_01010 pLX_304 0% 24.1% V5 1_295del;453_454ins71;666_1464del n/a
3 TRCN0000480569 AACCCTTTCACATTTGCCTTCATC pLX_317 81.1% 24.1% V5 1_295del;453_454ins71;666_1464del n/a
Download CSV