Transcript: Human XR_001741235.2

PREDICTED: Homo sapiens Kruppel like factor 3 (KLF3), transcript variant X3, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
KLF3 (51274)
Length:
3425
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_001741235.2
NBCI Gene record:
KLF3 (51274)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_001741235.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000016416 CAGTGTCATACCCATCTAATT pLKO.1 211 3UTR 100% 13.200 18.480 N KLF3 n/a
2 TRCN0000230826 AGTGTCATACCCATCTAATTA pLKO_005 212 3UTR 100% 15.000 10.500 N KLF3 n/a
3 TRCN0000218651 GAGGATACACAGATGTGATTA pLKO_005 1008 3UTR 100% 13.200 9.240 N KLF3 n/a
4 TRCN0000016414 CCCACTTGAAAGCACACAGAA pLKO.1 1061 3UTR 100% 4.950 3.465 N KLF3 n/a
5 TRCN0000016413 CGGAGGATACACAGATGTGAT pLKO.1 1006 3UTR 100% 4.950 3.465 N KLF3 n/a
6 TRCN0000229551 GTACCTGTAATTGAATCATAT pLKO_005 702 3UTR 100% 0.000 0.000 N Klf3 n/a
7 TRCN0000230828 GTACCTGTAATTGAATCATAT pLKO_005 702 3UTR 100% 0.000 0.000 N KLF3 n/a
8 TRCN0000230827 TTCTTCCAGCCCACCGATAAA pLKO_005 452 3UTR 100% 13.200 7.920 N KLF3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_001741235.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08267 pDONR223 100% 30.1% None (many diffs) n/a
2 ccsbBroad304_08267 pLX_304 0% 30.1% V5 (many diffs) n/a
3 TRCN0000476192 GCTGGGAGTCCGCCACAGGCGGTT pLX_317 32.4% 30.1% V5 (many diffs) n/a
Download CSV