Transcript: Human XR_001742094.1

PREDICTED: Homo sapiens proline rich 16 (PRR16), transcript variant X5, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
PRR16 (51334)
Length:
5609
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_001742094.1
NBCI Gene record:
PRR16 (51334)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_001742094.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000123215 CGAGAACGAGTTCGGTTTAAT pLKO.1 526 3UTR 100% 15.000 21.000 N PRR16 n/a
2 TRCN0000271253 GGCTAATGCACCGCTTATTAA pLKO_005 216 3UTR 100% 15.000 21.000 N PRR16 n/a
3 TRCN0000271251 ACCGTGTGATGTATGCCATTA pLKO_005 829 3UTR 100% 10.800 15.120 N PRR16 n/a
4 TRCN0000271252 TCCAACTGCCAATCCTGTAAA pLKO_005 345 3UTR 100% 13.200 9.240 N PRR16 n/a
5 TRCN0000123218 TGACTGTGATACCCGGTATAA pLKO.1 576 3UTR 100% 13.200 9.240 N PRR16 n/a
6 TRCN0000271254 TGCTGCATACCCAACAGTAAC pLKO_005 436 3UTR 100% 10.800 7.560 N PRR16 n/a
7 TRCN0000123216 CTTCTACGAAATGGAGGCTTA pLKO.1 379 3UTR 100% 4.050 2.835 N PRR16 n/a
8 TRCN0000123217 CCTTCTACGAAATGGAGGCTT pLKO.1 378 3UTR 100% 2.640 1.848 N PRR16 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_001742094.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11978 pDONR223 100% 12.4% None (many diffs) n/a
2 ccsbBroad304_11978 pLX_304 0% 12.4% V5 (many diffs) n/a
3 TRCN0000465699 CAGTTAAAACCCGCCCAATTCCAA pLX_317 24% 12.4% V5 (many diffs) n/a
Download CSV