Transcript: Human XR_001742364.1

PREDICTED: Homo sapiens synuclein alpha interacting protein (SNCAIP), transcript variant X26, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
SNCAIP (9627)
Length:
2353
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_001742364.1
NBCI Gene record:
SNCAIP (9627)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_001742364.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000156434 CACAGGAATCGCTGATGTGTA pLKO.1 514 3UTR 100% 4.950 6.930 N SNCAIP n/a
2 TRCN0000157213 GCCGAAGATGTGATACGCAAA pLKO.1 420 3UTR 100% 4.050 5.670 N SNCAIP n/a
3 TRCN0000085374 GCCTTATTCATTACGCAGGTT pLKO.1 1590 3UTR 100% 2.640 1.848 N Sncaip n/a
4 TRCN0000152655 GCCTTATTCATTACGCAGGTT pLKO.1 1590 3UTR 100% 2.640 1.848 N SNCAIP n/a
5 TRCN0000280250 GCCTTATTCATTACGCAGGTT pLKO_005 1590 3UTR 100% 2.640 1.848 N SNCAIP n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_001742364.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11395 pDONR223 100% 57.5% None (many diffs) n/a
2 ccsbBroad304_11395 pLX_304 0% 57.5% V5 (many diffs) n/a
3 TRCN0000476088 GCCCTACCTCTTATGCCTTCTACG pLX_317 11.1% 57.5% V5 (many diffs) n/a
Download CSV