Transcript: Human XR_001744720.1

PREDICTED: Homo sapiens von Willebrand factor C domain containing 2 (VWC2), transcript variant X1, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
VWC2 (375567)
Length:
3047
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_001744720.1
NBCI Gene record:
VWC2 (375567)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_001744720.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000426659 GGCAAGACCTATCAGACTTTG pLKO_005 689 3UTR 100% 10.800 15.120 N VWC2 n/a
2 TRCN0000155745 CGAGACATGAATGCAGGCAAA pLKO.1 978 3UTR 100% 4.050 5.670 N VWC2 n/a
3 TRCN0000151659 CAACAAGAACTTTGGGCATAA pLKO.1 1189 3UTR 100% 10.800 7.560 N VWC2 n/a
4 TRCN0000431121 TACTGATGTGAACATTCTAGA pLKO_005 1046 3UTR 100% 4.950 3.465 N VWC2 n/a
5 TRCN0000424805 TTGATAACAGTTACTACAACA pLKO_005 1141 3UTR 100% 4.950 3.465 N VWC2 n/a
6 TRCN0000155323 GAGGAAGAACTACTGCGAGTT pLKO.1 664 3UTR 100% 4.050 2.835 N VWC2 n/a
7 TRCN0000155718 CAGAGAAGTGAAGACTGACGA pLKO.1 892 3UTR 100% 2.640 1.848 N VWC2 n/a
8 TRCN0000155935 CCATGTGCACGAGACATGAAT pLKO.1 969 3UTR 100% 0.563 0.394 N VWC2 n/a
9 TRCN0000151885 CATATGCCACTGTACTTATGA pLKO.1 919 3UTR 100% 0.000 0.000 N VWC2 n/a
10 TRCN0000154815 GCACCATATGCCACTGTACTT pLKO.1 915 3UTR 100% 0.000 0.000 N VWC2 n/a
11 TRCN0000150326 CAGAACACAAACTCTGACTTT pLKO.1 1012 3UTR 100% 4.950 2.970 N VWC2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_001744720.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05550 pDONR223 100% 31.9% None 1_25del;1001_3047del n/a
2 ccsbBroad304_05550 pLX_304 0% 31.9% V5 1_25del;1001_3047del n/a
3 TRCN0000477460 CAAGGCACCCCGAGATTTTGCACT pLX_317 45.1% 31.9% V5 1_25del;1001_3047del n/a
Download CSV