Transcript: Human XR_001744879.2

PREDICTED: Homo sapiens caldesmon 1 (CALD1), transcript variant X8, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
CALD1 (800)
Length:
4338
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_001744879.2
NBCI Gene record:
CALD1 (800)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_001744879.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000157180 GCCGCATCAATGAATGGCTAA pLKO.1 1698 3UTR 100% 4.050 5.670 N CALD1 n/a
2 TRCN0000330608 GCCGCATCAATGAATGGCTAA pLKO_005 1698 3UTR 100% 4.050 5.670 N CALD1 n/a
3 TRCN0000330609 CTCAGTTGTAGAGGGCTAATT pLKO_005 2006 3UTR 100% 13.200 10.560 N CALD1 n/a
4 TRCN0000157319 CCAGAAGATGGCTTGTCAGAT pLKO.1 1334 3UTR 100% 4.950 3.465 N CALD1 n/a
5 TRCN0000330607 CCAGAAGATGGCTTGTCAGAT pLKO_005 1334 3UTR 100% 4.950 3.465 N CALD1 n/a
6 TRCN0000155691 CGCCAAGAAAGATACGAGATA pLKO.1 620 3UTR 100% 4.950 3.465 N CALD1 n/a
7 TRCN0000330606 CGCCAAGAAAGATACGAGATA pLKO_005 620 3UTR 100% 4.950 3.465 N CALD1 n/a
8 TRCN0000155194 GAAGAGTTCGAGAAGCTCAAA pLKO.1 1112 3UTR 100% 4.950 3.465 N CALD1 n/a
9 TRCN0000155917 CATGGATCGAAAGAAGGGATT pLKO.1 910 3UTR 100% 4.050 2.835 N CALD1 n/a
10 TRCN0000108680 GCCTGTTTCTAAAGAAACCAT pLKO.1 2175 3UTR 100% 0.300 0.210 N Cald1 n/a
11 TRCN0000303123 GCCTGTTTCTAAAGAAACCAT pLKO_005 2175 3UTR 100% 0.300 0.210 N Cald1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_001744879.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00206 pDONR223 100% 35.9% None (many diffs) n/a
2 ccsbBroad304_00206 pLX_304 0% 35.9% V5 (many diffs) n/a
3 TRCN0000469974 CCGTTCGTCACCGTGCTACGTCCA pLX_317 29% 35.9% V5 (many diffs) n/a
Download CSV