Transcript: Human XR_001747074.1

PREDICTED: Homo sapiens tetraspanin 15 (TSPAN15), transcript variant X5, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
TSPAN15 (23555)
Length:
860
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_001747074.1
NBCI Gene record:
TSPAN15 (23555)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_001747074.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000219082 GAGGAATTGAGAACTACTATG pLKO_005 517 3UTR 100% 10.800 15.120 N TSPAN15 n/a
2 TRCN0000381139 TCATCTATTCCACCGTGTTCT pLKO_005 202 3UTR 100% 4.950 6.930 N TSPAN15 n/a
3 TRCN0000157418 GCAAGAATCAGTACCACGACT pLKO.1 619 3UTR 100% 2.640 3.696 N TSPAN15 n/a
4 TRCN0000157727 CGACAGAAGTTGTCAACACCA pLKO.1 697 3UTR 100% 2.640 2.112 N TSPAN15 n/a
5 TRCN0000230019 CAGAGGTTGAGCGGCAGAAAT pLKO_005 262 3UTR 100% 13.200 9.240 N TSPAN15 n/a
6 TRCN0000230021 ACCGAGATTGGAGCAAGAATC pLKO_005 607 3UTR 100% 10.800 7.560 N TSPAN15 n/a
7 TRCN0000230020 ACTTCCTGAACGACAACATTC pLKO_005 493 3UTR 100% 10.800 7.560 N TSPAN15 n/a
8 TRCN0000380708 TGTTCATGGTCTCCTTCATTG pLKO_005 346 3UTR 100% 10.800 7.560 N TSPAN15 n/a
9 TRCN0000380762 TCCTACCTCTGGCTCAAGTTT pLKO_005 174 3UTR 100% 5.625 3.938 N TSPAN15 n/a
10 TRCN0000158160 CATCAGGAACACGACAGAAGT pLKO.1 686 3UTR 100% 4.950 3.465 N TSPAN15 n/a
11 TRCN0000153662 CCTTCTCCAAGCATTCATGTA pLKO.1 398 3UTR 100% 4.950 3.465 N TSPAN15 n/a
12 TRCN0000153446 CCAAGCATTCATGTACATCCT pLKO.1 404 3UTR 100% 2.640 1.848 N TSPAN15 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_001747074.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000477967 GTGCGGCTGTAGGATGTCGGGCCA pLX_317 57.8% 68% V5 (not translated due to frame shift) (many diffs) n/a
2 ccsbBroadEn_07901 pDONR223 100% 68% None (many diffs) n/a
3 ccsbBroad304_07901 pLX_304 0% 68% V5 (many diffs) n/a
Download CSV