Transcript: Human XR_001747246.2

PREDICTED: Homo sapiens RNA binding motif protein 17 (RBM17), transcript variant X1, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
RBM17 (84991)
Length:
3339
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_001747246.2
NBCI Gene record:
RBM17 (84991)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_001747246.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000231428 ACGAATATGACCCTATGTTTC pLKO_005 443 3UTR 100% 10.800 15.120 N RBM17 n/a
2 TRCN0000001200 AGGCGTAAAGACAGACATGAA pLKO.1 559 3UTR 100% 4.950 6.930 N RBM17 n/a
3 TRCN0000231431 GGCCTATTGGATGAATCATTT pLKO_005 2638 3UTR 100% 13.200 10.560 N RBM17 n/a
4 TRCN0000001201 GATGAAGCAGTACGGATATTT pLKO.1 1905 3UTR 100% 15.000 10.500 N RBM17 n/a
5 TRCN0000231430 GATGAAGCAGTACGGATATTT pLKO_005 1905 3UTR 100% 15.000 10.500 N RBM17 n/a
6 TRCN0000231429 ATACTTAAGTGTCCTACTAAA pLKO_005 1752 3UTR 100% 13.200 9.240 N RBM17 n/a
7 TRCN0000231427 TCCTCAGATGACCGGCAAATT pLKO_005 334 3UTR 100% 13.200 9.240 N RBM17 n/a
8 TRCN0000010600 CCGGTGATCCTTAAATGAACT pLKO.1 2091 3UTR 100% 4.950 3.465 N RBM17 n/a
9 TRCN0000001203 AGATGAAGATTATGAGCGAGA pLKO.1 621 3UTR 100% 2.160 1.512 N RBM17 n/a
10 TRCN0000001202 GAGAAAGTAGTGAAGCGCCAA pLKO.1 475 3UTR 100% 2.160 1.512 N RBM17 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_001747246.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09252 pDONR223 100% 35.9% None (many diffs) n/a
2 ccsbBroad304_09252 pLX_304 0% 35.9% V5 (many diffs) n/a
3 TRCN0000471626 CGACCTCAACTCGATCTCACGAAC pLX_317 43.9% 35.9% V5 (many diffs) n/a
4 ccsbBroadEn_14325 pDONR223 100% 35.9% None (many diffs) n/a
5 ccsbBroad304_14325 pLX_304 0% 35.9% V5 (not translated due to frame shift) (many diffs) n/a
6 TRCN0000469519 GATAAATCTCCATATCTAGACTGC pLX_317 31.4% 35.9% V5 (not translated due to frame shift) (many diffs) n/a
Download CSV