Transcript: Human XR_001747953.2

PREDICTED: Homo sapiens bestrophin 1 (BEST1), transcript variant X12, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
BEST1 (7439)
Length:
2520
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_001747953.2
NBCI Gene record:
BEST1 (7439)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_001747953.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000118744 GCTGCTATATGGCGAGTTCTT pLKO.1 780 3UTR 100% 4.950 6.930 N BEST1 n/a
2 TRCN0000121677 GCCTGAATCAAATGGTTAGCT pLKO.1 2333 3UTR 100% 3.000 4.200 N BEST1 n/a
3 TRCN0000118745 GTGGAGTTTAACCTGACGGAT pLKO.1 2066 3UTR 100% 2.640 3.696 N BEST1 n/a
4 TRCN0000419882 ATGCTCACGCTGGCATCATTG pLKO_005 1608 3UTR 100% 10.800 8.640 N BEST1 n/a
5 TRCN0000421544 GCCTACGACTGGATTAGTATC pLKO_005 1366 3UTR 100% 10.800 8.640 N BEST1 n/a
6 TRCN0000118742 ACAGCCTGAATCAAATGGTTA pLKO.1 2330 3UTR 100% 4.950 3.960 N BEST1 n/a
7 TRCN0000122830 GACTCTGTATTGCGACAGCTA pLKO.1 885 3UTR 100% 2.640 2.112 N BEST1 n/a
8 TRCN0000118746 GAACACAAGCAGTTGGAGAAA pLKO.1 1189 3UTR 100% 4.950 3.465 N BEST1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_001747953.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11219 pDONR223 100% 50.1% None (many diffs) n/a
2 ccsbBroad304_11219 pLX_304 0% 50.1% V5 (many diffs) n/a
3 TRCN0000479644 AATGTTTAAATGAGGAGGAAAATG pLX_317 23.2% 50.1% V5 (many diffs) n/a
Download CSV