Transcript: Human XR_001747994.2

PREDICTED: Homo sapiens SET binding factor 2 (SBF2), transcript variant X8, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
SBF2 (81846)
Length:
7311
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_001747994.2
NBCI Gene record:
SBF2 (81846)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_001747994.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000082767 GCGGTTCATTACCCGATTTAT pLKO.1 2586 3UTR 100% 15.000 21.000 N SBF2 n/a
2 TRCN0000231070 GCGGTTCATTACCCGATTTAT pLKO_005 2586 3UTR 100% 15.000 21.000 N SBF2 n/a
3 TRCN0000218581 CATTGACTCAGATCGACATTA pLKO_005 354 3UTR 100% 13.200 18.480 N SBF2 n/a
4 TRCN0000231071 CCGTTCAAGACCCGAGTATTT pLKO_005 3531 3UTR 100% 13.200 18.480 N SBF2 n/a
5 TRCN0000082766 CCGAATGTATTCACCTCTCTT pLKO.1 1046 3UTR 100% 4.950 6.930 N SBF2 n/a
6 TRCN0000082763 CCCTGTATCTTGCACTAAATT pLKO.1 5862 3UTR 100% 15.000 10.500 N SBF2 n/a
7 TRCN0000231069 GTGTTGGTATCCAGATTATAT pLKO_005 502 3UTR 100% 15.000 10.500 N SBF2 n/a
8 TRCN0000231072 TTGTTCTCTGAGGTCATAATT pLKO_005 6006 3UTR 100% 15.000 10.500 N SBF2 n/a
9 TRCN0000110163 CATCAACAGTTTGACTACATA pLKO.1 1951 3UTR 100% 5.625 3.938 N Sbf2 n/a
10 TRCN0000082764 CCCGATTTATTGACAAAGTTT pLKO.1 2597 3UTR 100% 5.625 3.938 N SBF2 n/a
11 TRCN0000082765 GCCTGTTGTATGTTGGAAGAA pLKO.1 3678 3UTR 100% 4.950 3.465 N SBF2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_001747994.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000469814 AGCACATGAAACATATGTGAGCCG pLX_317 7.9% 72.8% V5 (many diffs) n/a
Download CSV